MitomiRs, ChloromiRs and Modelling of the microRNA Inhibition

Abstract

MicroRNAs are non-coding parts of nuclear and mitochondrial genomes, preventing the weakest part of the genetic regulatory networks from being expressed and preventing the appearance of a too many attractors in these networks. They have also a great influence on the chromatin clock, which ensures the updating of the genetic regulatory networks. The post-transcriptional inhibitory activity by the microRNAs, which is partly unspecific, is due firstly to their possibly direct negative action during translation by hybridizing tRNAs, especially those inside the mitochondrion, hence slowing mitochondrial respiration, and secondly to their action on a large number of putative m-RNA targets like those involved in immunetworks; We show that the circuits in the core of the interaction graphs are responsible for the small number of dedicated attractors that correspond to genetically controlled functions, partly due to a general filtering by the microRNAs. We analyze this influence as well as their impact on important functions like the control by the p53 network over the apoptosis/proliferation system and the homeostasis of the energy metabolism. In this last case, we show the role of two kinds of microRNAs, both involved in the control of the mitochondrial genome: (1) nuclear microRNAs, called mitoMirs, inhibiting mitochondrial genes and (2) putative mitochondrial microRNAs inhibiting the tRNAs functioning.

Proto-ribosome: a theoretical approach based on RNA relics

“…4B) and matches the corresponding AL sequence with 4 mutations in practically all D-loops of the mitochondrial DNA of individuals human from 164 countries and ethnic groups, and great apes 51 . The icosamer anti-matches (in red) like a microRNA, a sequence of the mitochondrial translocase precursor ENSG00000154174 52 , an enzyme crucial for the cell energetics in human cells: GGTGTGAAGTGGCATCTCATGGTGGTTTTGGTTTGCATTTCCCTAATG Translocase CCATGACATGTTATA AGTACCACAGACCGTCATTACATGCTTTATGT D-loop, giving an argument in favor of the ancient role of AL as a negative feedback regulator in the early energetic cell metabolism 30,53,54 -the CRISPR-CAS system provides bacteria like Rhodobacter sphaeroides with adaptive immunity and we can notice that the AL-pentamers ATGGT and ATTCA, and hexamers TCAAGAT and AATGGT (corresponding respectively to the Tψ− and D-loops of many tRNAs) are often observed at many levels of this system (CAS proteins, Casposon TIR and CRISP repeats). For example, the typical repeat sequences for CRISPR1 and CRISPR3 55 contain AL-heptamers from tRNA loops: GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC (CRISPR1) GTTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAAC (CRISPR3) as well as the sequences of TIR and CRISPR compared in 56 , a consensus sequence from central part of the murine RSS VκL8, Jß2.6 and Jß2.2 [57][58][59] , and the human RSS spacer common for Vh, V328h2 and V328 60-62 : The probability p=2 10 -9 for 19 matches (with an insertion) between TIR and CRISPR using the binomial distribution B(1/4,22), p=8 10 -6 for 15 anti-matches between AL and CRISPR plus 1 quasi-anti-match G-T using the distribution B(1/4,21)xB(3/8,1), p=7 10 -4 for 13 matches between AL and consensus RSS using the binomial distribution B(1/4,22), p=2 10 -6 for 11 matches between AL and RSS spacer using the binomial distribution B(1/4,12)…”

Emergence of a “Cyclosome” in a Primitive Network Capable of Building “Infinite” Proteins

“…The 25 selected rings satisfy two opposite constraints corresponding to a min-max problem: (i) to be as short as possible, and (ii) to contain one and only one triplet corresponding to each amino acid synonymy class. The latter constraint would allow the rings to serve as a “matrimonial agency” concentrating amino acids in the vicinity of the ring and thereby favoring the links between any pair of them via peptide bonds [48,49,50,51,52,53,54,55]. The 25 RNA rings selected can be considered as ancestors of the tRNA of the 22 AAs including Pyrrolysine and Selenocysteine (Figure 3), with Serine counted twice, and Tyrosine and Aspartic Acid able to replace C by U in their tRNA anticodons [56,57].…”

Insights into the Regulatory Role of Non-coding RNAs in Cancer Metabolism

“…Therefore, mitochondrial ncRNAs may participate in the fine-tuning of the mitochondrial energy supply. A recent study identified 13 miRNAs significantly enriched in mitochondria of HeLa cells, which actively participate in cell cycle and apoptosis through regulation of mitochondrial activity (Bandiera et al, 2011 ; Demongeot et al, 2013 ). The lncRNAs encoded by mtDNA, ASncmtRNA-1/2, are down-regulated in cancer cells and take part in the mitochondrial reprograming of oncogenic pathways (Burzio et al, 2009 ).…”