Mitogenic Signals Stimulate the CREB Coactivator CRTC3 through PP2A Recruitment

Abstract

SummaryThe second messenger 3′,5′-cyclic adenosine monophosphate (cAMP) stimulates gene expression via the cAMP-regulated transcriptional coactivator (CRTC) family of cAMP response element-binding protein coactivators. In the basal state, CRTCs are phosphorylated by salt-inducible kinases (SIKs) and sequestered in the cytoplasm by 14-3-3 proteins. cAMP signaling inhibits the SIKs, leading to CRTC dephosphorylation and nuclear translocation. Here we show that although all CRTCs are regulated by SIKs, their interactions with Ser/Thr-specific protein phosphatases are distinct. CRTC1 and CRTC2 associate selectively with the calcium-dependent phosphatase calcineurin, whereas CRTC3 interacts with B55 PP2A holoenzymes via a conserved PP2A-binding region (amino acids 380–401). CRTC3-PP2A complex formation was induced by phosphorylation of CRTC3 at S391, facilitating the subsequent activation of CRTC3 by dephosphorylation at 14-3-3 binding sites. As stimulation of mitogenic pathways promoted S391 phosphorylation via the activation of ERKs and CDKs, our results demonstrate how a ubiquitous phosphatase enables cross talk between growth factor and cAMP signaling pathways at the level of a transcriptional coactivator.

Anabolic and Pro-metabolic Functions of CREB-CRTC in Skeletal Muscle: Advantages and Obstacles for Type 2 Diabetes and Cancer Cachexia

“…CRTCs are held in latent cytosolic complexes with 14-3-3 proteins due to phosphorylation (21, 22) by AMPK-related kinases: salt inducible kinases (SIK1, SIK2, and SIK3) (21, 23), AMPKα1, AMPKα2 (24), and MARK2 (25). cAMP-PKA signaling inhibits these kinases, and calcium or growth-factor signaling activates calcineurin or protein phosphatase 2A (PP2A) (21, 22, 26). The convergence of these signals results in CRTC de-phosphorylation and nuclear entry.…”

Transcriptional co-activator regulates melanocyte differentiation and oncogenesis by integrating cAMP and MAPK/ERK pathways

“…Correspondingly, loss of CRTC3 blocked melanin production and re-expression of CRTC3 rescued these effects, but the overexpression of CRTC2 did not. Notably, over-expression of the hybrid CRTC2 protein containing the PP2A binding domain of CRTC3 48 was competent to rescue melanin synthesis ( Fig. 3b).…”

“…We hypothesized that CRTC3 may be selectively activated in melanocytes by signals other than cAMP or by low levels of cAMP that are otherwise insufficient to activate CRTC1 and CRTC2. ERK1/2-mediated phosphorylation of CRTC3 at Ser 391 increases its interaction with protein phosphatase 2 (PP2A), leading to the dephosphorylation of CRTC3 at inhibitory 14-3-3 binding sites 48 . Exposure of B16F1 cells to several ERK1/2 activators (SCF, HGF, TPA) promoted the phosphorylation of CRTC3 at Ser 391 ( Fig.…”

“…Female New Zealand white rabbits (10-12 weeks old; I.F.P.S. Inc., Norco, California, USA) were used for mOCA2 antibody production as previously described 48 . OCA2 synthetic peptide (Cys 27 mOCA2(2-27)-NH2) was synthesized by RS Synthesis (Louisville, KY) and conjugated to maleimide activated Keyhole Limpet Hemocyanin (KLH) per manufacturer's instructions (77610, Thermo Fisher).…”

“…CTRL cells were transfected with the empty vector.Single clones were selected by fluorescenceactivated cell sorting (Becton-Dickinson Influx™ cytometer) after 48 hours. The gRNAs target exons 1 and 3 of CRTC1 and exons 1 and 8 of CRTC3: mC1g1: 5' CACCGTGACAGGGGTCGACGGTGCG 3' ex3 mC1g2: 5' CACCGTCACCCGCGCGGCCCGCGTC 3' ex1 mC3g1: 5' CACCGCATCAAGCCGATAATGTTCG 3' ex1 mC3g2: 5' CACCGAGCCACTGCCTAAACACCTG 3' ex8Rescue experiments were performed by transfecting clonal B16F1 CRTC3 KO cells with pSelect-puro-mcs plasmid (psetp_mcs, Invivogen) carrying full length CRTC3, CRTC2, OCA2, CRTC3-Ser 391 A or CRTC2/3 hybrid constructs (CRTC2328-449 exchanged for CRTC3326-402, as previously decribed48 ), cloned into SalI and NheI sites. Transfected cells were selected with 2µg/ml puromycin for at least 7 days before initial testing.…”