Mitochondrial ribosome and Ménière’s disease: a pilot study

Abstract

Ménière's disease patients experience vestibular disability. When most of medical treatments fail, a chemical labyrinthectomy using aminoglycosides is indicated. However, this process frequently causes hearing damage. Aminoglycosides, interacting with mitochondrial rRNAs, alter mitochondrial protein synthesis and the oxidative phosphorylation system, which provide most of the energy in sensory hair cells. For this reason, we hypothesized that genetic variation in mitochondrial rRNA genes and in two nuclear genes coding for proteins that also modify the susceptibility to aminoglycosides might affect the risk of hearing loss in Ménière's disease patients suffering chemical labyrinthectomy. However, there were no differences in mitochondrial rRNA, TFB1M or MRPS12 genetic variation between those patients that experienced or did not experience hearing loss. This is only a pilot study and larger studies are required to use this therapeutic approach in a rational way and decrease the risk of hearing damage.

Rise and dissemination of aminoglycoside resistance: the aac(6′)-Ib paradigm

“…The fact that aminoglycosides also cause a decrease in eukaryotic translational fidelity permitted to initiate efforts to developed them as drugs to treat nonsense mutation related genetic disorders such as cystic fibrosis and Duchenne muscular dystrophy (Rich et al, 1990; Kellermayer, 2006; Hermann, 2007; Kondo et al, 2007; Zingman et al, 2007; Bidou et al, 2012; Kandasamy et al, 2012). A chemical labyrinthectomy using intratympanic injection of aminoglycosides is used when most treatments of Ménière's disease fail (Huon et al, 2012; Pacheu-Grau et al, 2012). Aminoglycoside-based drugs are also inhibitors of reproduction of the HIV virus, a property that could result in their utilization in the treatment of AIDS patients (Houghton et al, 2010).…”

An MRPS12 mutation modifies aminoglycoside sensitivity caused by 12S rRNA mutations

“…Ten became deaf and eleven retained their hearing ability. However, they did not have the mt-rRNA pathogenic mutation and we did not discover amino acid substitutions that could explain the phenotype (Pacheu-Grau et al, 2012 ).…”

“…To locate mutations, the human rCRS (GenBank NC_012920) was used. The sequencing of Cercopithecidae MRPS12 was also performed as already explained (Pacheu-Grau et al, 2012 ), but using specific primers for these species Fw: CACTAAGATCTGTTCTCTGCC and Rv: ACTCCACAAGGGTTCACATC. To locate mutations, the Macaca mulatta MRPS12 cDNA (Ensembl Transcript Id: ENSMMUT00000038520) was used.…”

New MT‐ND1 pathologic mutation for Leber hereditary optic neuropathy

“…The presence of the m.3472T>C mutation in Spaniard controls and patients suffering from optic neuropathy was performed by PCR‐RFLP or qRT‐PCR, respectively. This qRT‐PCR was performed with TaqMan reagents including two primers around the m.3472T>C position and two probes: a fluorophore VIC‐labelled probe specific for one allele and other fluorophore FAM‐labelled probe specific for the other allele . The mtDNA levels were determined according protocols previously published …”

“…This qRT-PCR was performed with TaqMan reagents including two primers around the m.3472T>C position and two probes: a fluorophore VIC-labelled probe specific for one allele and other fluorophore FAM-labelled probe specific for the other allele. 6 The mtDNA levels were determined according protocols previously published. 5 Construction and maintenance of transmitochondrial cell lines.…”