Mitochondrial Phospholipid Homeostasis Is Regulated by the i-AAA Protease PaIAP and Affects Organismic Aging

Abstract

Mitochondria are ubiquitous organelles of eukaryotic organisms with a number of essential functions, including synthesis of iron-sulfur clusters, amino acids, lipids, and adenosine triphosphate (ATP). During aging of the fungal aging model Podospora anserina, the inner mitochondrial membrane (IMM) undergoes prominent morphological alterations, ultimately resulting in functional impairments. Since phospholipids (PLs) are key components of biological membranes, maintenance of membrane plasticity and integrity via regulation of PL biosynthesis is indispensable. Here, we report results from a lipidomic analysis of isolated mitochondria from P. anserina that revealed an age-related reorganization of the mitochondrial PL profile and the involvement of the i-AAA protease PaIAP in proteolytic regulation of PL metabolism. The absence of PaIAP enhances biosynthesis of characteristic mitochondrial PLs, leads to significant alterations in the acyl composition of the mitochondrial signature PL cardiolipin (CL), and induces mitophagy. These alterations presumably cause the lifespan increase of the PaIap deletion mutant under standard growth conditions. However, PaIAP is required at elevated temperatures and for degradation of superfluous CL synthase PaCRD1 during glycolytic growth. Overall, our study uncovers a prominent role of PaIAP in the regulation of PL homeostasis in order to adapt membrane plasticity to fluctuating environmental conditions as they occur in nature.

Disruption of the MICOS complex leads to an aberrant cristae structure and an unexpected, pronounced lifespan extension in Podospora anserina

“…The longevity of MICOS mutants is a counterintuitive finding, since manipulation of the two other cristae-shaping components, F 1 F o -ATP-synthase and cardiolipin, has negative effects on organismic aging in P. anserina leading to lifespan reduction (Löser et al, 2021; Rampelt et al, 2017). Therefore, we asked how these opposing effects on the lifespan could occur.…”

“…The weak phenotype of ΔPaMic12 can also be explained by independent roles of the two MICOS subcomplexes, which are not affected upon loss of the coupling factor (Figure 1B,C). The longevity of MICOS mutants is a counterintuitive finding, since manipulation of the two other cristaeshaping components, F1Fo-ATP-synthase and cardiolipin, has negative effects on organismic aging in P. anserina leading to lifespan reduction (Löser et al, 2021;Rampelt et al, 2017). Therefore, we asked how these opposing effects on the lifespan could occur.…”

Lifespan Increase of Podospora anserina by Oleic Acid Is Linked to Alterations in Energy Metabolism, Membrane Trafficking and Autophagy

“…The amplification product was subsequently digested with KpnI (Thermo Scientific, Waltham, MA, USA; ER0521). Insert 2 covers the mCherry gene and was amplified with oligonucleotides mCherry-P (ATGGTGAGCAAGGGCGAGGA, 5 phosphate; Biomers, Ulm, Germany) and mCherryR-ClaI (GCCCATCGATCTTGTACAGCT CGTCCATGC, ClaI site underlined; Biomers, Ulm, Germany) from template pLS1 [14] and finally digested with ClaI (Thermo Scientific, Waltham, MA, USA; ER0141). To generate plasmid pSnc1-A, insert 1 and 2 were cloned in the ClaI/KpnI digested backbone of plasmid pKO6 [2].…”

“…The PCR product was digested with BamHI. In parallel, the mCherry gene was amplified with mCherry-P (ATGGTGAGCAAGGGCGAGGA, 5 phosphate; Biomers, Ulm, Germany) and MOMTFPrev (GCCCTCTAGATTACTTGTACAGCTCGTCCATGC, XbaI site underlined; Biomers, Ulm, Germany) using pLS1 as a template [14] and subsequently digested with XbaI. Both inserts were cloned into the BamHI/XbaI backbone of pExMtterhph.…”

“…The hygromycin resistance gene hph was detected with a NcoI/ClaI-digested fragment from the pKO7 plasmid [21]. A specific mCherry fragment was amplified from the pLS1 [14] plasmid using the oligonucleotides mCherry-P and mCherryR-ClaI. The PaAtg37-specific probe contains a PaAtg37-fragment amplified with oligonucleotides Atg37-1 (GGAGCAAGACAAGTGGGATG; Biomers, Ulm, Germany) and Atg37-2 (TCCCTCAACGCGGCGATTTC; Biomers, Ulm, Germany).…”