Mitochondrial Changes in β0-Thalassemia/Hb E Disease

Abstract

The compound β°-thalassemia/Hb E hemoglobinopathy is characterized by an unusually large range of presentation from essentially asymptomatic to a severe transfusion dependent state. While a number of factors are known that moderate presentation, these factors do not account for the full spectrum of presentation. Mitochondria are subcellular organelles that are pivotal in a number of cellular processes including oxidative phosphorylation and apoptosis. A mitochondrial protein enriched proteome was determined and validated from erythroblasts from normal controls and β°-thalassemia/Hb E patients of different severities. Mitochondria were evaluated through the use of mitotracker staining, analysis of relative mitochondrial genome number and evaluation of mitochondrial gene expression in addition to assay of overall cellular redox status through the use of alamarBlue assays. Fifty differentially regulated mitochondrial proteins were identified. Mitotracker staining revealed significant differences in staining between normal control erythroblasts and those from β°-thalassemia/Hb E patients. Differences in relative mitochondria number and gene expression were seen primarily in day 10 cells. Significant differences were seen in redox status as evaluated by alamarBlue staining in newly isolated CD34+ cells. Mitochondria mediate oxidative phosphorylation and apoptosis, both of which are known to be dysregulated in differentiating erythrocytes from β°-thalassemia/Hb E patients. The evidence presented here suggest that there are inherent differences in these cells as early as the erythroid progenitor cell stage, and that maximum deficit is seen coincident with high levels of globin gene expression.

Oral ferroportin inhibitor ameliorates ineffective erythropoiesis in a model of β-thalassemia

“…Reticulocytes of healthy individuals clear mitochondria by mitophagy during maturation, and terminally differentiated RBCs produce energy by glycolysis (29). However, it has been shown that mitophagy in β-thalassemia is impaired, resulting in retention of mitochondria in mature RBCs (30,31). Flow cytometry analysis of MitoTracker-labeled blood cells showed that essentially all reticulocytes from both WT and Hbb th3/+ mice contained mitochondria (MitoTracker + cells, Figure 9A).…”

Analysis of protein profiling studies of β‐thalassemia/Hb E disease

“…In this study, Khungwanmaythawee et al. investigated the differential expression of mitochondrial proteins isolated from normal controls and β‐thalassemia/Hb E patients of different severities . Although 50 differentially regulated mitochondrial proteins were identified, none of them matched any protein identified by the earlier studies.…”

Nevirapine induced mitochondrial dysfunction in HepG2 cells

“…DNA purity was verified by determining the absorbance ratio of OD 260/280 and all samples were in the ratio range 1.8–2.0. Mitochondria were quantitated by qPCR essentially as described previously 47 , with each reaction containing 50 ng DNA template, 1X KAPA SYBR FastMaster Mix (Kapa biosystems, Inc., Wilmington, MA.) and 300 nM of the following specific primers: CYTB-mtDNA-f 5′AACTTCGGCTCACTCCTTGG3′, CYTB-mtDNA-r 5′CCAATGTATGGGATGGCGGA3′, FPN1A-nDNA-f 5′-CAAACCGCTTCCATAAGGCTTTGC3′, FPN1A-nDNA-r 5′-TTCTGCGGCTGCTATCGCTG-3′.…”