Misfolded opsin mutants display elevatedβ‐sheet structure

Abstract

Mutations in rhodopsin can cause misfolding and aggregation of the receptor, which leads to retinitis pigmentosa, a progressive retinal degenerative disease. The structure adopted by misfolded opsin mutants and the associated cell toxicity is poorly understood. Förster resonance energy transfer (FRET) and Fourier transform infrared (FTIR) microspectroscopy were utilized to probe within cells the structures formed by G188R and P23H opsins, which are misfolding mutants that cause autosomal dominant retinitis pigmentosa. Both mutants formed aggregates in the endoplasmic reticulum and exhibited altered secondary structure with elevated β-sheet and reduced α-helical content. The newly formed β-sheet structure may facilitate the aggregation of misfolded opsin mutants. The effects observed for the mutants were unrelated to retention of opsin molecules in the endoplasmic reticulum itself.

Quaternary structures of opsin in live cells revealed by FRET spectrometry

“…The vectors pmRho-SYFP2-1D4 and pmRho-mTq-1D4 were generated as described previously [46, 47]. The full CMV promoter in these vectors was replaced by a truncated CMV promoter to decrease the expression level of rhodopsin.…”

Wild-type opsin does not aggregate with a misfolded opsin mutant

“…The vectors pmRho-SYFP2-1D4, pmRhoG188R-SYFP2-1D4, and pmTq-C1 were generated as described previously [33, 37]. The following forward and reverse primers were used to amplify the sequence for mTq by PCR using pmTq-C1 as the template: 5′ ACGA TGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGA and 5′ CATCGTGCGGCCGCTAAGGCTGGAGCCACCTGGCTGGTCTCCGTCTTGTACAGC TCGTCCATGC.…”

“…This generated a PCR product with EcoRI and AgeI restriction endonuclease sites at the 5′ and 3′ ends, respectively. This PCR product was inserted into the vector pSYFP2-1D4-N1 [33] at the EcoRI and AgeI restriction endonuclease sites to generate the vector pFLAG-m2-SYFP2-1D4. The sequence for SYFP2-1D4 was replaced by the sequence for mTq-1D4 as described earlier to generate the vector pFLAG-m2-mTq-1D4, which was used in transfections.…”

“…Förster resonance energy transfer (FRET) methods provide a tool to investigate protein–protein interactions within a cellular context [31]. FRET has been used to study the oligomerization of wild-type opsin and aggregation of P23H and G188R misfolding opsin mutants in COS-1 or HEK293 cells [4,32,33]. FRET has also been used to investigate the physical interactions between the P23H misfolding opsin mutant and wild-type opsins in HEK293 cells [25].…”

“…The G188R opsin mutant, similarly to the more common P23H opsin mutant, misfolds, aggregates, and causes adRP [33–36]. However, the G188R mutation results in a more severe misfolding phenotype compared to the P23H mutation since all of the receptor molecules are misfolded and incapable of binding the chromophore 11- cis retinal [2,34,35].…”