miR‐211 sponges lncRNA MALAT1 to suppress tumor growth and progression through inhibiting PHF19 in ovarian carcinoma

Abstract

Accumulating evidence has indicated that microRNAs (miRNAs) play an important role in the occurrence and progression of ovarian cancer (OC). However, the function of miRNAs implicated in OC remains unclear. This study investigated the potential role of miR-211 in OC. Gene Expression Omnibus database analysis indicated that miR-211 expression was significantly down-regulated in OC tissues compared with normal specimens. In addition, miR-211 overexpression apparently inhibited proliferation, migration, xenograft growth, and induced apoptosis in HEY-T30 and SKOV3 cells. Moreover, PHF19, a component of the polycomb group of proteins, was found to be a direct target of miR-211 based on the luciferase reporter assay and Western blot analysis. Consistently, survival analysis indicated that high PHF19 expression was associated with shorter survival time in patients with OC. Importantly, silence of PHF19 reduced proliferation, induced cell cycle arrest, promoted apoptosis, suppressed migration, and inhibited xenograft growth in SKOV3 cells. Restoration of PHF19 expression markedly reversed the inhibitory effect of miR-211 on OC. Moreover, our results indicate that the long noncoding RNA MALAT1 could sponge miR-211 as a competing endogenous RNA and potentially up-regulate PHF19 expression, thus facilitating the OC progression. These findings suggest that the MALAT1/miR-211/PHF19 axis may act as a key mediator in OC and provide new insight into the prevention of this disease.-Tao, F., Tian, X., Ruan, S., Shen, M., Zhang, Z. miR-211 sponges lncRNA MALAT1 to suppress tumor growth and progression through inhibiting PHF19 in ovarian carcinoma.

LINC00346 Acts as a Competing Endogenous RNA Regulating Development of Hepatocellular Carcinoma via Modulating CDK1/CCNB1 Axis

“…In the study of LINC00346 on HCC, we found that LINC00346 significantly promoted the invasion and inhibited cell apoptosis of HCC through the competitive adsorption of miR-199a-3p to promote the expressions of CDK1/CCNB1. In recent years, lncRNAs analysis and functional assays for various types of cancer have provided increasing evidence supporting the critical role of lncRNAs in HCC tumor growth and progression, such as HOTAIR , MALAT1 (Tao et al, 2018) and TUG1 . Previous studies have found that LINC00346 is up-regulated in HCC tissues (Zhang et al, 2015).…”

Long non-coding RNA FAM83H-AS1 acts as an oncogenic driver in human ovarian cancer

“…For example, wang et al found that miR-211 inhibited most of DNA damage response-related genes, and proposed that miR-211 might affect the sensitivity of OC cells to platinum by targeting multiple DNA damage responserelated genes and thereby determine the prognosis of OC [32]. In addition, miR-211 could sponge lncRNA MALAT1 to suppress tumor growth and progression through inhibiting PHF19 in OC [33]. We could infer that FAM83H-AS1 maybe also play a key role in OC based on above results.…”

PHD Finger Protein 19 Enhances the Resistance of Ovarian Cancer Cells to Compound Fuling Granule by Protecting Cell Growth, Invasion, Migration, and Stemness

“…In myeloma, PHF19 promotes its tumorigenesis through activating PRC2 complex (Ren et al, 2019). In our previous study, we have also preliminarily proved that PHF19 may act as an oncogene in ovarian cancer SKOV3 cells by using RNAi technology (Tao et al, 2018b), however, its exact role in the biological behaviors of ovarian cancer, especially its role in drug-resistance, needs to be further investigated. Moreover, the findings that CFG exerts an anti-tumor effect and PHF19 functions as an oncogenic role in ovarian cancer promote us to examine the relationship between CFG and PHF19 in ovarian cancer.…”

“…The following primers were used: PHF19 forward: ACTCGGGACTCCTATGGTGC, PHF19 reverse: CCTCCGTCAGTTTGGACATCA; GAPDH forward: GGTGGTCTCCTCTGACTTCAACA, GAPDH reverse: GTTGCTGTAGCCAAATTCGTTGT. RT-qPCR for miR-211 detection was performed as previously described (Tao et al, 2018b).…”

“…Moreover, this increase in expression correlated with cancer progression (Wang et al, 2004). After that, accumulating evidence uncover the oncogenic role of PHF19 in a wide range of tumors (Ghislin et al, 2012;Xu et al, 2015;Lu et al, 2018;Tao et al, 2018b;Ren et al, 2019). For instance, PHF19 knockdown reduces the cell proliferation rate and increases the migration capacities of melanoma cells (Ghislin et al, 2012).…”