Microsatellite polymorphism in the human heme oxygenase-1 gene promoter and its application in association studies with Alzheimer and Parkinson disease

Abstract

Oxidative stress has been suggested to be involved in the pathogenesis of neurodegenerative diseases, such as Alzheimer disease (AD) and Parkinson disease (PD). Heme oxygenase-1 (HO-1), a key enzyme in heme catabolism, also functions as an antioxidant enzyme. Here, we show that a (GT)n repeat in the human HO-1 gene promoter region is highly polymorphic, although no particular alleles are associated with AD or PD. This newly identified genetic marker should allow us to study the possible involvement of HO-1 in certain human diseases.

Genetic variants and cell-free hemoglobin processing in sickle cell nephropathy

“…The 5'-flanking region containing (GT)n repeats of HMOX1 was amplified by PCR with a 5-carboxyfluorescein-labeled forward primer (AGAGCCTGCAGCTTCTCAGA) and standard reverse primer (ACAAAGTCTGGCCATAGGAC), as described previously. 46 Samples were amplified using AccuPrime™ SuperMix II (Life Technologies, Grand Island, NY, USA) with an initial denaturation step at 94°C for 2 min, followed by 35 cycles of 30 s at 94°C, 30 s at 60°C, and 1 min at 68°C. The PCR products were mixed together with GeneScan 600 LIZ size standard and analyzed using a 3730XL ABI sequencer.…”

Beyond SNPs and CNV: Pharmacogenomics of Polymorphic Tandem Repeats

“…The GT repeat in HMOX1 gene is one of the most extensively characterized examples of regulatory polymorphic microsatellites, and detailed mechanistic study of HMOX1 gene expression helped to elucidate the role of polymorphic STR in its promoter. HMOX1 gene contains a microsatellite sequence in the promoter region with a variable number of 10-43 GT repeats [20]. The effect of polymorphic STR in the HMOX1 promoter on the gene expression was extensively studied using reporter constructs, gene expression experiments in patients' samples, and enzymatic activity.…”

“…Di-and tetra-nucleotide STR constitute about 75% of STR, with the remaining loci containing tri-, penta-, and hexanucleotide repeats. The overall STR density in the human genome is comparable across chromosomes (mean ± SD=13,613 ± 1,887 bp/Mb), with chromosome 19 showing the highest STR density (20,351 bp/Mb) [5]. Within genes, microsatellite repeats are non-randomly distributed across protein-coding sequences, untranslated regions (UTRs), and introns.…”

Development of inhibitory antibodies to therapeutic factor VIII in severe hemophilia A is associated with microsatellite polymorphisms in the HMOX1 promoter

“…To date, three polymorphisms in the 5' flanking region have been described: two single nucleotide polymorphisms -413 T>A (rs2071746) and -1135 G>A (rs2071749) and a (GT) n repeat dinucleotide length polymorphism. 23 The number of (GT) repeats modulates gene transcription; 24 long (GT) n repeats are associated with low levels of HO-1 expression in response to a given stimulus, while short (GT) n repeats are associated with high expression levels. 25 For instance, umbilical endothelial cells (HUVEC) from healthy donors with fewer than 23 GT repeats produce more HO-1 in vitro than HUVEC from healthy donors with ≥32 GT repeats following stimulation with H 2 O 2 .…”

“…28 The 5'-flanking region of the HO-1 gene containing the (GT) n dinucleotide repeat was amplified as described elsewhere. 23 A polymerase chain reaction (PCR) was performed using sense primer 5'-AGCAAAAT-CACACCCAGAGC-3', carrying a 6-FAM fluorescent label and downstream primer 5'-CCCTTGGGAAACAAAGTCTG-3', 23 and using Amplitaq Gold buffer (Applied Biosystems, Courtaboeuf, France) with 2.5 mM MgCl 2 , 200 μM dNTP (Roche Diagnostics, Mannheim, Germany), 10 pmol of each oligonucleotide primer, 100-200 ng of genomic DNA and 1 U AmpliTaq Gold Taq polymerase (Applied Biosystems). After an initial denaturation for 10 min at 94 °C, 30 cycles (94°C for 20 s, 60°C for 10 s and 72°C for 20 s) were carried out and followed by a final extension at 72 °C for 5 min, in the presence of the GeneScan 500 Rox (Applera France, Villebon Sur Yvette, France) size standard and analyzed on an automated 3700 DNA fragments analyzer (Applied Biosystems).…”