microRNA-3646 serves as a diagnostic marker and mediates the inflammatory response induced by acute coronary syndrome

Yu, Jinming; Li, Yongmei; Leng, Deguo; Cao, Chunmei; Yu, Yang; Wang, Yijuan

doi:10.1080/21655979.2021.1967066

Cited by 5 publications

(4 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This plays to the potential advantages of stable expression, ease of detection, and relevance to the clinicopathology of miRNAs. For example, miR-142-3p [ 6 ], miR-3464 [ 8 ], and miR-4286 [ 26 ] were identified as potential diagnostic or predictive biomarkers for ACS.…”

Section: Discussionmentioning

confidence: 99%

“…Furthermore, miRNA has been proposed as a clinical biomarker for cardiovascular disease owing to its stable presence in various biological fluids (such as blood, serum, urine, and saliva) and its extracellular secretion that can be easily quantified by reverse transcription-quantitative real-time PCR (RT-qPCR). miR-142-3p [ 6 ], miR-941 [ 7 ], miR-3646 [ 8 ], and miR-497-5p [ 9 ] and miR-361-5p [ 10 ] were identified as promising biomarkers for ACS. miR-483-5p is a mature miRNA consisting of a 22 nucleotide (AAGACGGGAGGAAAGAAGGGAG) located on chromosome 11p15.5.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Circulating mir-483-5p as a novel diagnostic biomarker for acute coronary syndrome and its predictive value for the clinical outcome after PCI

Zhao¹,

Ru²,

Ma³

et al. 2023

BMC Cardiovasc Disord

View full text Add to dashboard Cite

Background MicroRNA (miRNA) plays a critical function in the progression of acute coronary syndrome (ACS) and is associated with major adverse cardiovascular events (MACEs) after undergoing percutaneous coronary intervention (PCI). This research was designed to probe the diagnostic accuracy of miR-483-5p in patients with ACS and its predictive value of MACEs. Methods 118 patients with ACS (40 with unstable angina pectoris [UAP] and 78 with acute myocardial infarction [AMI]) and 75 healthy controls were enrolled. Serum miR-483-5p was detected in the subjects by reverse transcription-quantitative real-time PCR (RT-qPCR). ROC curve and logistic regression models were employed to estimate the diagnosis. Patients were monitored for 6 months after PCI to document the occurrence of MACEs. Kaplan-Meier survival was conducted to explore the predictive significance of miR-483-5p for the MACEs. Results Serum miR-483-5p levels were higher in ACS patients and associated with SYNTAX score and Gensini score. miR-483-5p was effective in identifying ACS patients from healthy individuals (AUC = 0.919) and AMI patients from ACS patients (AUC = 0.867), demonstrating a high diagnostic value, proven by logistic regression (OR = 9.664, 95%CI = 4.462–20.928, P < 0.001). The prevalence of MACEs during follow-up were 24.58%, and a higher prevalence of MACEs were observed in patients with elevated miR-483-5p (P = 0.01). miR-483-5p was also an effective predictor of MACE occurrence (HR = 5.955, 95%CI = 1.928–18.389, P = 0.002). Conclusion Expression of serum miR-483-5p can be utilized as a non-invasive marker for diagnosing ACS and predicting the onset of MACE after PCI.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Circulating mir-483-5p as a novel diagnostic biomarker for acute coronary syndrome and its predictive value for the clinical outcome after PCI

Zhao¹,

Ru²,

Ma³

et al. 2023

BMC Cardiovasc Disord

View full text Add to dashboard Cite

show abstract

“…miR-486-3p is a stable biomarker for ACS diagnosis [ 27 ]. miR-3646 distinguishes ACS patients from healthy volunteers and mediates the inflammatory response [ 28 ]. However, the usefulness of miR-497-5p in cardiovascular and cerebrovascular disease has been noted.…”

Section: Discussionmentioning

confidence: 99%

Serum miR-497-5p serves as a diagnostic biomarker for acute coronary syndrome and predicts the occurrence of major adverse cardiovascular events after percutaneous coronary intervention

et al. 2022

View full text Add to dashboard Cite

This study aimed to investigate the diagnostic value of microRNA (miR)-497-5p in acute coronary syndrome (ACS) and its predictive value for the occurrence of adverse major adverse cardiovascular events (MACEs). Real-time quantitative polymerase chain reaction (RT-qPCR) was performed to detect the expression of serum miR-497-5p in 110 ACS patients and 82 controls. And miR-497-5p levels were found to be significantly elevated in the patients (P < 0.001). Pearson correlation coefficient confirmed that miR-497-5p was positively correlated with Gensini scores (r = 0.684). The area under the Receiver-operating characteristic (ROC) curve was 0.861, which significantly identified patients with ACS, and was confirmed by logistic regression (OR = 8.533, 95%CI = 4.113–17.787, P < 0.001). Kaplan-Meier and Cox regression was performed to evaluate the predictive value of miR-497-5p in the occurrence of MACEs during a 6-month follow-up after percutaneous coronary intervention (PCI) in patients with ACS. The results demonstrated that miR-497-5p was an independent predictor of MACEs (HR = 4.773, 95%CI = 1.569–12.036, P = 0.013) and that patients with high level of miR-497-5p were more likely to develop MACEs after PCI (long-rank P = 0.019). Finally, miR-497-5p positively correlated with endothelial proinflammatory and adhesion factors. Our study suggests that serum miR-497-5p is a potential diagnostic marker for ACS and its elevated levels can predict a high risk of MACEs in ACS patients after PCI. And this may be associated with vascular endothelial injury.

show abstract

“…The mechanisms underlying ACS progression are mediated by multiple molecules [ 37–40 ], and numerous previous studies have based their research on the use of public databases or certain molecules for the study of ACS. Notably, ACS and in-stent restenosis have rarely been studied at the level of the transcriptome.…”

Section: Discussionmentioning

confidence: 99%

Identification of key molecular markers of acute coronary syndrome using peripheral blood transcriptome sequencing analysis and mRNA-lncRNA co-expression network construction

Shen

Gong

et al. 2021

Bioengineered

View full text Add to dashboard Cite

Acute coronary syndrome (ACS) is a term used to describe major cardiovascular diseases, and treatment of in-stent restenosis in patients with ACS remains a major clinical challenge. Further investigation into molecular markers of ACS may aid early diagnosis, and the treatment of ACS and post-treatment recurrence. In the present study, total RNA was extracted from the peripheral blood samples of 3 patients with ACS, 3 patients with percutaneous coronary intervention (PCI)_non-restenosis, 3 patients with PCI_restenosis and 3 healthy controls. Subsequently, RNA library construction and high-throughput sequencing were performed. DESeq2 package in R was used to screen genes that were differentially expressed between the different samples. Moreover, the intersection of the differentially expressed mRNAs (DEmRNAs) and differentially expressed long noncoding RNAs (DElncRNAs) obtained. GeneCodis4.0 was used to perform function enrichment for DEmRNAs, and lncRNA-mRNA co-expression network was constructed. The GSE60993 dataset was utilized for diagnostic analysis, and the aforementioned investigations were verified using in vitro studies. Results of the present study revealed a large number of DEmRNAs and DElncRNAs in the different groups. We selected genes in the top 10 of differential expression and also involved in the co-expression of lncRNA-mRNA for diagnostic analysis in the GSE60993 dataset. The area under curve (AUC) of PDZK1IP1 (0.747), PROK2 (0.769) and LAMP3 (0.725) were all >0.7. These results indicated that the identified mRNAs and lncRNAs may act as potential clinical biomarkers, and more specifically, PDZK1IP1, PROK2 and LAMP3 may act as potential biomarkers for the diagnosis of ACS.

show abstract

microRNA-3646 serves as a diagnostic marker and mediates the inflammatory response induced by acute coronary syndrome

Cited by 5 publications

References 32 publications

Circulating mir-483-5p as a novel diagnostic biomarker for acute coronary syndrome and its predictive value for the clinical outcome after PCI

Circulating mir-483-5p as a novel diagnostic biomarker for acute coronary syndrome and its predictive value for the clinical outcome after PCI

Serum miR-497-5p serves as a diagnostic biomarker for acute coronary syndrome and predicts the occurrence of major adverse cardiovascular events after percutaneous coronary intervention

Identification of key molecular markers of acute coronary syndrome using peripheral blood transcriptome sequencing analysis and mRNA-lncRNA co-expression network construction

Contact Info

Product

Resources

About