Microcosm-based interaction studies between members of two ecophysiological groups of bioemulsifier producer and a hydrocarbon degrader from the Indian intertidal zone

Abstract

Isolates were obtained from intertidal zone site samples from all five western and one eastern coastal states of India and were screened. These ecophysiological groups of aerobic, mesophilic, heterotrophic, sporulating, and bioemulsifier-producing bacteria were from Planococcaceae and Bacillaceae. This is the first report of bioemulsifier production by Sporosarcina spp., Lysinibacillus spp., B. thuringiensis, and B. flexus. In this group, Solibacillus silvestris AM1 was found to produce the highest emulsification activity (62.5 %EI) and the sample that yielded it was used to isolate the ecophysiological group of non-bioemulsifier-producing, hydrocarbon-degrading bacteria (belonging to Chromatiales and Bacillales). These yielded hitherto unreported degrader, Rheinheimera sp. CO6 which was selected for the interaction studies (in a microcosm) with bioemulsifier-producing S. silvestris AM1. The gas chromatographic study of these microcosm experiments revealed increased degradation of benzene, toluene, and xylene (BTX) and the growth of Rheinheimera sp. CO6 in the presence of bioemulsifier produced by S. silvestris AM1. Enhancement of the growth of S. silvestris AM1 in the presence of Rheinheimera sp. CO6 was observed possibly due to reduced toxicity of BTX suggesting mutualistic association between the two. This study elucidates the presence and interaction between enhancers and degraders in a hydrocarbon-contaminated intertidal zone and contributes to the knowledge during application of the two in remediation processes.

Characterization of Solibacillus silvestris strain AM1 that produces amyloid bioemulsifier

“…b). In oligotrophic conditions mimicking the bacterium's native source , it was seen that the cell bound bioemulsifier release was faster than earlier reported and its release was in timed to increase with respect to the production on the cell surface. The growth of the bacterium was earlier reported to be going into stationary at 12 h , and thus it can be seen here that the oligotrophic conditions directly affect the bacterial numbers at 12 h of growth.…”

“…S. silvestris AM1 was isolated from Vellar estuary, Parangipette, Tamil Nadu, India as reported by us previously using Zobell Marine (Table ) medium. The culture was submitted to Microbial Cultural Collection centre, NCCS, Pune, India (Accession No.…”

“…MCC2096). The 16S rRNA gene fragment of S. silvestris AM1 was amplified with eubacterial universal primers (27f, 5′‐GAGAGTTTGATCCTGGCTCAG‐3′; 1107r, 5′‐GCTCGTTGCGGGACTTAACC‐3′ and 1541r, 5′‐AAGGAGGTGATCCAGCCGC‐3′) as described in Markande and Nerurkar , sequenced (Xcelris labs, Ahmedabad, India) and was submitted to NCBI GenBank (Accession number GU226320). S. silvestris AM1 could produce amyloid bioemulsifier BE‐AM1 only in ZM medium .…”

“…Phylogenetic clustering of all the available 16S rDNA sequences of strains of S. silvestris is carried out for the first time in this study. Recently, we reported a protein bioemulsifier producing strain S. silvestris AM1 and its bioemulsifier termed BE‐AM1 to be an amyloid in nature . In this study, further biochemical, chemotaxonomic and molecular characterization of S. silvestris AM1 has been carried out.…”

Analysis of Nutritional Factors Influencing the Biosynthesis of Amyloid Bioemulsifier Be-Am1 Applicable in Food Industry

“…S. silvestris AM1 was reported previously for the production of amyloid bioemulsifiers BE-AM1 having the ability to produce stable emulsions in aliphatic and aromatic hydrocarbons (Markande et al, 2013). This bioemulsifiers was further reported to be thermostable amyloid protein (Markande & Nerurkar, 2016a) and capable of interacting with degraders for enhancement of remediation (Markande & Nerurkar, 2016b). BE-AM1 production by S. silvestris AM1 was consistent in pH and NaCl concentrations variations, but was affected by temperature variation due its influence on bacterial growth.…”