Microbial and Transcriptomic Profiling Reveals Diet-Related Alterations of Metabolism in Metabolic Disordered Mice

Abstract

Metabolic disorders are the prelude of metabolic diseases, which are mainly due to the high-energy intake and genetic contribution. High-fat diet (HFD) or high-sucrose diet is widely used for inducing metabolic disorders characterized by increased body weight, insulin resistance, hepatic steatosis, and alteration of gut microbiome. However, the triangle relationship among diets, gut microbiome, and host metabolism is poorly understood. In our study, we investigated the dynamic changes in gut microbiota, and host metabolism in mice that were fed with either chow diet, HFD, or chow diet with 30% sucrose in drinking water (HSD) for continued 12 weeks. The gut microbiota was analyzed with 16S rDNA sequencing on feces. Hepatic gene expression profile was tested with transcriptomics analysis on liver tissue. The host metabolism was evaluated by measuring body weight, insulin sensitivity, serum lipids, and expression of proteins involved in lipid metabolism of liver. The results showed that HFD feeding affected body weight, insulin resistance, and hepatic steatosis more significantly than HSD feeding. 16S rRNA gene sequencing showed that HFD rapidly and steadily suppressed species richness, altered microbiota structure and function, and increased the abundance of bacteria responsible for fatty acid metabolism and inflammatory signaling. In contrast, HSD had minor impact on the overall bacteria structure or function but activated microbial bile acid biosynthesis. Fecal microbiota transplantation suggested that some metabolic changes induced by HFD or HSD feeding were transferrable, especially in the weight of white adipose tissue and hepatic triglyceride level that were consistent with the phenotypes in donor mice. Moreover, transcriptomic results showed that HFD feeding significantly inhibited fatty acid degradation and increase inflammation, while HSD increased hepatic de novo lipogenesis and inhibited primary bile acid synthesis alternative pathway. In general, our study revealed the dynamic and diversified impacts of HFD and HSD on gut microbiota and host metabolism.

High Fat Diet and High Sucrose Intake Divergently Induce Dysregulation of Glucose Homeostasis through Distinct Gut Microbiota-Derived Bile Acid Metabolism in Mice

“…First of all, the Unweighted UniFrac principal coordinate analysis (PCoA) showed that HFD groups had dramatically different patterns of gut microbiota with Con and HSD groups. Con and HSD groups clustered together based on PCoA and hierarchical clustering tree analysis (Figure a,b), suggesting that the gut microbial composition was similar between the HSD and Con groups rather than the HFD group, which is consistent with previous reports . In addition, HFD reduced Chao and Shannon index, with no difference between Con and HSD, suggesting HSD had no effect on bacterial richness and evenness (Figure c).…”

“…The genomic DNA extraction and processing, as well as the quality control of raw sequencing data, were conducted in accordance with previous study. 18 Total bacterial genomic DNA samples were obtained from cecal content. Subsequently, PCR amplification of the bacterial 16S rRNA gene V3−V4 region was executed using the universal primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTA-CHVGGGTWTCTAAT).…”

“…However, previous study reported that high-calorie diets differing in fat-to-sugar ratio resulted in different microbiota but similar diabetic states and metabolite profiles . Our previous investigation unveiled the dynamic and divergent effects of a high fat diet (HFD) and a high sucrose diet (HSD) on gut microbiota and host metabolism during short-term feeding . Therefore, two questions arise: whether fat and sucrose have different effects on host glucose homeostasis and which metabolite leads to this disparity.…”

“…17 Our previous investigation unveiled the dynamic and divergent effects of a high fat diet (HFD) and a high sucrose diet (HSD) on gut microbiota and host metabolism during short-term feeding. 18 Therefore, two questions arise: whether fat and sucrose have different effects on host glucose homeostasis and which metabolite leads to this disparity. Gut microbiota-derived metabolites are key molecular mediators in host−gut microbiota interaction, exerting a profound influence on the physiology and pathophysiology of T2DM.…”

Exploring the potential mechanism of Rubus corchorifolius L. fruit polyphenol-rich extract in mitigating non-alcoholic fatty liver disease by integration of metabolomics and transcriptomics profiling

“…Previous research showed that HFD feeding significantly pressed fatty acid degradation pathway and primary bile acid synthesis pathway in transcriptomic analysis, which is consistent with our previous results. 40 Lipids, particularly LDL-C, represent a significant risk factor for the onset for atherosclerosis, cardiovascular diseases and their complications. 41 As such, the pathways of lipid and atherosclerosis are intricately intertwined with lipid metabolism.…”