Microarray‐based identification of aminopeptidase N target genes in keratinocyte conditioned medium‐stimulated dermal fibroblasts

Abstract

Of the many processes that affect the outcome of wound repair, epidermal-dermal interactions are essential to extracellular matrix (ECM) remodeling and in particular, soluble factors released by keratinocytes are known to have a direct impact on the production of ECM by dermal fibroblasts. Aminopeptidase N (APN) has recently been proposed as a cell-surface receptor for stratifin and is responsible for the stratifin-mediated matrix metalloproteinase-1 (MMP-1) upregulation in fibroblasts. The present study examines whether modulation of APN gene expression has any impact on the fibroblast ECM gene expression profile. The result reveals that in the presence of keratinocyte-derived soluble factors, transient knockdown of APN in dermal fibroblasts affects the expression of key ECM components such as fibronectin, tenascin-C, MMP-1, MMP-3, and MMP-12. The regulatory effects of APN on fibronectin and selective MMPs appear to be associated with receptor-mediated signal transduction independently of its peptidase activity. On the contrary, inhibition of the APN enzymatic activity by bestatin significantly reduces the tenascin-C expression and enhances the contraction of fibroblast-populated collagen gel, suggesting an activity-dependent regulation of fibroblast contractility by APN. The overall effects of APN on the expression of fibronectin, tenascin-C, and MMPs in fibroblasts propose an important role for APN in the regulation of keratinocyte-mediated ECM remodeling and fibroblast contractile activity.

Differential Gene Expression Profiling of Mouse Uterine Luminal Epithelium During Periimplantation

“…46 Tmprss11d and Tmprss13 encode proteases. 47 –49 Anpep is also called CD13 , encoding a membrane protein that plays a role in digesting peptides and may also play roles in regulating keratinocyte-mediated ECM remodeling and fibroblast contractile activity 50 as well as immune responses. 51 Fxyd4 encodes a regulator of the Na, K-ATPase.…”

“…46 Tmprss11d and Tmprss13 encode proteases. [47][48][49] Anpep is also called CD13, encoding a membrane protein that plays a role in digesting peptides and may also play roles in regulating keratinocyte-mediated ECM remodeling and fibroblast contractile activity 50 as well as immune responses. 51 Fxyd4 Abbreviations: D3.5, gestation day 3.5, preimplantation; D4.5, gestation day 4.5, postimplantation; E2, 17b-estradiol; P4, progesterone; IS, implantation site; inter-IS, interimplantation site; LE, luminal epithelium; GE, glandular epithelium.…”

Recombinant human collagen III gel for transplantation of autologous skin cells in porcine full-thickness wounds

“…It is also possible that the activated fibroblasts in turn modulate keratinocyte responses. Moreover, it was recently reported that keratinocytes can induce proteolytic activation of fibroblasts in an aminopeptidase N ‐dependent manner (Lai et al ., ). The dramatic change in rhCol‐III kinetics induced by cell type in vivo demonstrates that care should be taken to identify the cell populations before mixing them in the carrier gel.…”

CD13 Inhibition Enhances Cytotoxic Effect of Chemotherapy Agents

“…Cells were seeded on a 96-well plate and transfected with siRNA targeting the sequence of CCGAAATGCCACACTGGTCAA of the human ANPEP (CD13) sequence (NM_001150) ( Lai et al, 2012 ). Non-specific scrambled siRNA duplex was also purchased from GenePharma (Shanghai, China).…”