2010
DOI: 10.1590/s1516-89132010000400013
| View full text |Cite
|
Sign up to set email alerts
|

Abstract: In this work, genomic DNA of Streptococcus pyogenes, S. mutans and S. sobrinus was isolated using two methods: either using the detergent cetyltrimethylammonium bromide (CTAB) at 65ºC; or by applying ultrasound to a mixture of silica and celite in CTAB. The composite method that used ultrasound was the more efficient, allowing the straightforward extraction of genomic DNA from Gram-positive bacteria with good quality and reproducibility.

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
1
1
1

Citation Types

0
10
0
2

Year Published

2012
2012
2019
2019

Publication Types

Select...
4
1

Relationship

0
5

Authors

Journals

citations
Cited by 17 publications
(12 citation statements)
references
References 19 publications
(14 reference statements)
0
10
0
2
Order By: Relevance
“…A total of sixty three B. cereus isolates were cultured in nutrient agar and then extraction of genomic DNA were made according to the protocol adapted from Moreira et al (2010). The concentration of the obtained DNA were determined using a spectrophotometer (Nanodrop 2000, Thermo Scientific, Wilmington-MA, USA) and dilutions were made, when necessary, to set the concentration at 100 μg/mL.…”
Section: Methodsmentioning
confidence: 99%
“…Overnight cultures of single pure colonies in nutrient broth were used for DNA extraction according to the protocol of Moreira et al (2010). DNA quantification was performed using Qubit (Invitrogen  ).…”
Section: Isolation and Identification Of Microorganismsmentioning
confidence: 99%
“…Para bactérias a extração de DNA foi realizada de acordo com o protocolo de Moreira et al (2010). Os isolados foram cultivados em Caldo Nutriente e após o período de incubação, as culturas foram centrifugadas a 49000 x g por 2 min e o sedimento transferido para um microtubo de volume 1,5mL, contendo uma mistura de sílica em pó e celite 2:1, e tampão CTAB.…”
Section: Identificação Molecularunclassified
“…Method 1: using SDS (sodium dodecyl sulfate 1%), proteinase K, chloroform: isoamyl alcohol and ethanol (Moreira et al, 2010) Method 5: using lysozyme, proteinase K, STE (2.5% SDS, 10 mM Tris-HCl, 0.25 M EDTA), ammonium acetate, chloroform: isoamyl alcohol and isopropanol (Luz, 2008).…”
Section: Dna Extractionmentioning
confidence: 99%
“…Extraction of genomic DNA of the isolate was performed according to the method [13] . The 16S ribosomal RNA gene was amplified using the PCR with Taq DNA polymerase and primers F (AGAGTTTGATCCTGGCTCAG) and R (ACGGCTACCTTGTTACGACTT).…”
Section: Molecular Identificationmentioning
confidence: 99%