Metabolic engineering of Escherichia colifor the biosynthesis of alpha-pinene

Abstract

Backgroundα-Pinene is an important natural product that is widely used in flavorings, fragrances, medicines, fine chemicals and high-density renewable fuels. Currently, α-Pinene used in industry is mainly produced either by tapping trees (gum turpentine) or as a byproduct of paper pulping (crude sulfate turpentine, CST). However, the extraction of it from trees is tedious and inefficient and requires substantial expenditure of natural resources. Therefore, it is necessary to seek sustainable technologies for α-pinene production.ResultsTo construct the microbial synthetic pathway of α-pinene in E. coli, we co-expressed native geranyl diphosphate synthase (IspA) from E. coli and α-pinene synthase (Pt30) from Pinus taeda, and then to increase the geranyl diphosphate (GPP) content in the cells, a suitable geranyl diphosphate synthase (GPPS2) was selected from two different origins. Furthermore, to enhance α-pinene production, a novel biosynthetic pathway of α-pinene was assembled in E. coli BL21(DE3) with the heterologous hybrid mevalonate (MVA) pathway, GPPS2 and α-pinene synthase (Pt30). The final genetic strain, YJM28, harboring the above novel biosynthetic pathway of α-pinene, accumulated α-pinene up to 5.44 mg/L and 0.97 g/L under flask and fed-batch fermentation conditions, respectively. The conversion efficiency of glucose to α-pinene (gram to gram) in the metabolically engineered strain reached 2.61%.ConclusionsIn this paper, by using metabolic engineering techniques, the more efficient biosynthetic pathway of α-pinene was successfully assembled in E. coli BL21(DE3) with the heterologous hybrid MVA pathway, GPPS2 and α-pinene synthase (Pt30). In addition, this is the first report on α-pinene fed-batch fermentation, and our results represent improvements over previous reports.

Utilization of alkaline phosphatase PhoA in the bioproduction of geraniol by metabolically engineered Escherichia coli

“…Plasmid pYJM26 and pYJM14, which harboring the heterologous mevalonate pathway and geranyl diphosphate synthase gene from Abies grandis, were constructed in our lab's early study. 17 The phoA pYJM14 pTrcHis2B carrying ERG12, ERG8, ERG19 and IDI1 from Saccharomyces cerevisiae,Amp r gene was PCR-amplified from plasmid DNA of pYY11 with the primer sets phoA-rbs-F (GGAAGATCTAGGAGGTAAAAAA-TATGCGGACACCAGAAATGCCTGTTC) and phoA-R (CACCTCGAGTTATTTCAGCCCCAGAGCGGC). The PCR product was digested with BglII and XhoI respectively and then ligated into the corresponding sites of pYJM26 cut with the same restriction enzymes, creating pLWG9.…”

Functional characterization of a geraniol synthase-encoding gene from Camptotheca acuminata and its application in production of geraniol in Escherichia coli

“…The present work showed that geraniol production was increased to 48.5 ± 0.9 mg L −1 by engineering tCaGES and the foreign genes mentioned above. The geraniol yield of this study is higher than those in transgenic tobacco and yeast; also, parallel to or higher than the yields of other terpenes production in metabolically engineered microorganisms [23,32,39,40,42]. Recently it has been demonstrated that deletion of YjgB, an endogenous dehydrogenase responsible for geraniol loss in E. coli MG1655, will increase geraniol production to 182.5 mg L −1 [38].…”

“…In addition, the fed-batch fermentation was proved to increase the yields of other terpenes [23,39,40,42]. Thus, this study will be an alternative to selectively produce geraniol in engineered E. coli, together with other metabolic engineering methods such as balancing the whole biosynthetic pathway and using fed-batch fermentation.…”

Isoprenoids Production from Lipid-Extracted Microalgal Biomass Residues Using the Engineered <em>E. coli</em>

“…Engineered E. coli strain, YJM25 was used during isoprene fermentation [20], YJM29 was utilized in α-pinene biosynthesis [21] and FHR-2 (E. coli BL21 (DE3) (pACYDuet-1-mvaE-mvaS-GPPS2-QH6, pTrcHis2B-ERG8-ERG12-ERG19-IDI1) was applied for β-pinene production [22]. The fermentation procedure was carried out as reported in the previous study [23] with some modifications.…”

“…Optical density (OD) of the bacteria was measured with a spectrophotometer (Cary-50, Varian Inc. USA) at a wavelength of 600 nm. The isoprene, α-pinene and β-pinene production were analyzed as described earlier [20][21][22] by a gas chromatograph (GC) equipped with a flame ionization detector (FID) and a HP-1 column (30 m×0.25 mm×0.25 μm, Agilent). The concentration of target production was calculated with peak area on the bases of a standard curve.…”