Metabarcoding reveals a more complex cyanobacterial community than morphological identification

Li, Xiaochuang; Huo, Shouliang; Zhang, Jingtian; Ma, Chunzi; Xiao, Zhe; Zhang, Hanxiao; Xi, Beidou; Xia, Xinghui

doi:10.1016/j.ecolind.2019.105653

Cited by 20 publications

(15 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The fraction of fish species detected by both methods indicates that the concordance is good between DNA metabarcoding and the traditional approaches. This result is in line with conclusions from individual studies (e.g., Hänfling et al, 2016 ; Li et al, 2019a , 2019b ; Pont et al, 2018 ; Valentini et al, 2016 ) and with a recent synthesis by McElroy et al ( 2020 ). The good match between taxonomic lists generated by the two approaches can be explained by the limited regional diversity of fish communities investigated in the available studies.…”

Section: Discussionsupporting

confidence: 90%

“…Second, to ensure the continuity of long‐term traditional monitoring time series. Accordingly, many case‐ or site‐specific studies have attempted to estimate the congruence between the two approaches, that is, comparing the diversity of organisms assessed with DNA metabarcoding to assessments with traditional methods (e.g., Abad et al, 2016 ; Cahill et al, 2018 ; Fernández et al, 2018 ; Hänfling et al, 2016 ; Leese et al, 2021 ; Li et al, 2019a , 2019b ; Mächler et al, 2019 ; Vasselon et al, 2017 ). These studies have not only been conducted on a broad range of aquatic ecosystems, individual study sites and organismal groups, but are also reporting a wide range of comparability versus divergence to classically assessed community data.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Meta‐analysis shows both congruence and complementarity of DNA and eDNA metabarcoding to traditional methods for biological community assessment

et al. 2022

View full text Add to dashboard Cite

DNA metabarcoding is increasingly used for the assessment of aquatic communities, and numerous studies have investigated the consistency of this technique with traditional morpho‐taxonomic approaches. These individual studies have used DNA metabarcoding to assess diversity and community structure of aquatic organisms both in marine and freshwater systems globally over the last decade. However, a systematic analysis of the comparability and effectiveness of DNA‐based community assessment across all of these studies has hitherto been lacking. Here, we performed the first meta‐analysis of available studies comparing traditional methods and DNA metabarcoding to measure and assess biological diversity of key aquatic groups, including plankton, microphytobentos, macroinvertebrates, and fish. Across 215 data sets, we found that DNA metabarcoding provides richness estimates that are globally consistent to those obtained using traditional methods, both at local and regional scale. DNA metabarcoding also generates species inventories that are highly congruent with traditional methods for fish. Contrastingly, species inventories of plankton, microphytobenthos and macroinvertebrates obtained by DNA metabarcoding showed pronounced differences to traditional methods, missing some taxa but at the same time detecting otherwise overseen diversity. The method is generally sufficiently advanced to study the composition of fish communities and replace more invasive traditional methods. For smaller organisms, like macroinvertebrates, plankton and microphytobenthos, DNA metabarcoding may continue to give complementary rather than identical estimates compared to traditional approaches. Systematic and comparable data collection will increase the understanding of different aspects of this complementarity, and increase the effectiveness of the method and adequate interpretation of the results.

show abstract

Section: Discussionsupporting

confidence: 90%

Section: Introductionmentioning

confidence: 99%

Meta‐analysis shows both congruence and complementarity of DNA and eDNA metabarcoding to traditional methods for biological community assessment

et al. 2022

View full text Add to dashboard Cite

show abstract

“…The full-length 16S rDNA gene was amplified from the bacterial DNA by PCR using barcode 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (CGGTTACCTTGTTACGACTT) primers as described previously [40]. Following PCR amplification, PCR products were subjected to 1% agarose gel electrophoresis and stained with ethidium bromide for 40 min at 100 V. The sequences were aligned using DNAman software (Lynnon Corp., Quebec, Canada) and then compared with the 16S rRNA sequences in the NCBI database [41,42]. Identifications were preliminarily made at a genus/species level based on similarity values of >99%.…”

Section: Sanger Identificationmentioning

confidence: 99%

Profiling of Plant Growth-Promoting Metabolites by Phosphate-Solubilizing Bacteria in Maize Rhizosphere

Shen

Dong

et al. 2021

Plants

View full text Add to dashboard Cite

Microbial treatment has recently been attracting attention as a sustainable agricultural strategy addressing the current problems caused by unreasonable agricultural practices. However, the mechanism through which microbial inoculants promote plant growth is not well understood. In this study, two phosphate-solubilizing bacteria (PSB) were screened, and their growth-promoting abilities were explored. At day 7 (D7), the lengths of the root and sprout with three microbial treatments, M16, M44, and the combination of M16 and M44 (Com), were significantly greater than those with the non-microbial control, with mean values of 9.08 and 4.73, 7.15 and 4.83, and 13.98 and 5.68 cm, respectively. At day 14 (D14), M16, M44, and Com significantly increased not only the length of the root and sprout but also the underground and aboveground biomass. Differential metabolites were identified, and various amino acids, amino acid derivatives, and other plant growth-regulating molecules were significantly enhanced by the three microbial treatments. The profiling of key metabolites associated with plant growth in different microbial treatments showed consistent results with their performances in the germination experiment, which revealed the metabolic mechanism of plant growth-promoting processes mediated by screened PSB. This study provides a theoretical basis for the application of PSB in sustainable agriculture.

show abstract

“…Surprising results uncovering polyphyly and changing taxonomic position have been found from the molecular revisions of many cyanobacterial taxa (e.g., Komárková et al 2010;Komárek et al 2016) and therefore the relations between the genus Microcrocis and Merismopedia (and its subgenera) should be verified as well. Moreover, previous studies, marginally touching the phylogeny of Merismopedia suggested its clearly polyphyletic status (Rajaniemi-Wacklin et al 2006;Shen et al 2018;Li et al 2019Li et al , 2020. So far, no molecular data concerning Microcrocis, not even ultrastructural ones are known (NCBI Resource Coordinators 2018; Mareš et al 2019b).…”

Section: Introductionmentioning

confidence: 99%

“…This methodological approach was called the "polyphasic approach" or alternatively "total evidence approach" (Johansen & Casamatta 2005;Komárek 2010;Mareš et al 2019a). A new taxon may be described -apart from traditional morphological criteria -either via the provision of a sequence or a suitable genetic marker novel to a database and sufficiently distinguishable from others (Dvořák et al 2018;Li et al 2019). Additionally, polyphasic, phylogeny-based approach accepting just monophyletic taxa revealed ubiquitous cryptic diversity in the Cyanobacterial systematics (e.g., Johansen et al 2021).…”

Section: Introductionmentioning

confidence: 99%

Unsuspected findings about phylogeny and ultrastructure of the enigmatic cyanobacterium Microcrocis geminata resulted in its epitypification and novel placement in Geminocystaceae

Pokorný¹,

Štenclová²,

Kaštovský³

2023

Fottea

View full text Add to dashboard Cite

The genus Microcrocis belongs to long ago established cyanobacterial taxa for which relevant data required for a modern taxonomic analysis remained unknown for a long time. In present study we proposed an epitype originating from a large natural population of the type species M. geminata. Through isolating clean individual colonies from the environmental sample, sufficient material for a single colony PCR and amplification of genomic DNA by MDA method was obtained. Molecular analyses of the 16S rRNA gene determined the unsuspected position of the cyanobacterium within the family Geminocystaceae, forming a distinct branch with two Merismopedia sequences. 16S rRNA and ITS analysis clearly separated the two taxa on generic level. The phylogenetic classification is conspicuously consistent with the ultrastructure of parallel thylakoids unique for some members of the family Geminocystaceae. Distinctive morphology of the genus including typical longitudinal division is discussed.

show abstract

Metabarcoding reveals a more complex cyanobacterial community than morphological identification

Cited by 20 publications

References 41 publications

Meta‐analysis shows both congruence and complementarity of DNA and eDNA metabarcoding to traditional methods for biological community assessment

Meta‐analysis shows both congruence and complementarity of DNA and eDNA metabarcoding to traditional methods for biological community assessment

Profiling of Plant Growth-Promoting Metabolites by Phosphate-Solubilizing Bacteria in Maize Rhizosphere

Unsuspected findings about phylogeny and ultrastructure of the enigmatic cyanobacterium Microcrocis geminata resulted in its epitypification and novel placement in Geminocystaceae

Contact Info

Product

Resources

About