MET Inhibition Sensitizes Rhabdomyosarcoma Cells to NOTCH Signaling Suppression

Abstract

Rhabdomyosarcoma (RMS) is a pediatric myogenic soft tissue sarcoma. The Fusion-Positive (FP) subtype expresses the chimeric protein PAX3-FOXO1 (P3F) while the Fusion-Negative (FN) is devoid of any gene translocation. FP-RMS and metastatic FN-RMS are often unresponsive to conventional therapy. Therefore, novel therapeutic approaches are needed to halt tumor progression. NOTCH signaling has oncogenic functions in RMS and its pharmacologic inhibition through γ-secretase inhibitors blocks tumor growth in vitro and in vivo. Here, we show that NOTCH signaling blockade resulted in the up-regulation and phosphorylation of the MET oncogene in both RH30 (FP-RMS) and RD (FN-RMS) cell lines. Pharmacologic inhibition of either NOTCH or MET signaling slowed proliferation and restrained cell survival compared to control cells partly by increasing Annexin V and CASP3/7 activation. Co-treatment with NOTCH and MET inhibitors significantly amplified these effects and enhanced PARP1 cleavage in both cell lines. Moreover, it severely hampered cell migration, colony formation, and anchorage-independent growth compared to single-agent treatments in both cell lines and significantly prevented the growth of FN-RMS cells grown as spheroids. Collectively, our results unveil the overexpression of the MET oncogene by NOTCH signaling targeting in RMS cells and show that MET pathway blockade sensitizes them to NOTCH inhibition.

Spermine oxidase induces DNA damage and sensitizes fusion negative rhabdomyosarcoma cells to irradiation

“…For migration assay, the cells were seeded at 100% of confluence on 96-well plate using Oris Cell Migration Assay Kit (#CMA1.101, Platypus Technologies, Madison, WI, United States) according to manufacturer instructions. Analysis of cell migration into the detection zone was performed after fixing and staining with Diff-Quick ® (460.053, Medion Diagnostic AG, Düdingen, Switzerland) as reported in ( Perrone et al, 2022 ). The images were taken using the Leica microscope Leica DMi8 with LAS X Navigator image acquisition software.…”

“…For 3D tumor spheroids, RD and JR1 cells, transduced with pBABE and pSMOX retrovirus, were seeded in 100 µL of complete growth media on 96 Ultra-Low Attachment (#7007) (CORNING, New York, United States) well plates as previously described ( Perrone et al, 2022 ). Diameters of spheroids were evaluated every 24 h using Celigo image cytometer (Nexcelom Bioscience, Lawrence, MA, United States).…”

A MYOD-SKP2 axis boosts tumorigenesis in fusion negative rhabdomyosarcoma by preventing differentiation through p57Kip2 targeting

“…Transient RNA interference. Cells were transfected as described in 65 with siRNAs against either human SKP2 (SASI_Hs02_00340672s), mouse SKP2 (SASI_Mm02_00322740), human MYOD (custom: CUUGCCACAACGGACGACUU), human p27 (custom: ACGUAAACAGCUCGAAUUA), human p57 (custom: GAACCGGCUGGGAUUACGACUU) or with a non-targeting siRNA as control (SIC001) (Sigma-Aldrich, St Louis, MO, USA) (100 nM final concentration) using Oligofectamine (Invitrogen, Carlsbad, CA), according to the manufacturer's recommendations. Twenty-four hours later, the medium was replaced with fresh growth medium supplemented with 10% FBS, 1% Lglutamine and 1% penicillin-streptomycin, and the transfected cells were harvested at different time points.…”

Radioresistance in rhabdomyosarcomas: Much more than a question of dose

“…Recent evidence suggests that CSCs of several malignancies, also comprehending RMS, can resist ionizing radiation because of their peculiar metabolic status, associated with high expression of genes and pathways related to stem-like features, activated DNA repair mechanisms ( 232 ), and altered levels of free radical scavenger levels ( 233 ). Specifically, several studies have demonstrated the specific molecular pathways contributing to the CSC intrinsic radioresistance, such as PI3K/Akt/mTOR and NOTCH ones ( 234 – 237 ), which upregulates ROS scavenging enzymes ( 238 ). Thus, inhibiting NOTCH could be the efficient strategy to radiosensitize CSCs, bypassing their ability to detoxify from ROS.…”