Mesenchymal stem cell-based HSP70 promoter-driven VEGFA induction by resveratrol promotes angiogenesis in a mouse model

Abstract

Several studies of stem cell-based gene therapy have indicated that long-lasting regeneration following vessel ischemia may be stimulated through VEGFA gene therapy and/or MSC transplantation for reduction of ischemic injury in limb ischemia and heart failure. The therapeutic potential of MSC transplantation can be further improved by genetically modifying MSCs with genes which enhance angiogenesis following ischemic injury. In the present study, we aimed to develop an approach in MSC-based therapy for repair and mitigation of ischemic injury and regeneration of damaged tissues in ischemic disease. HSP70 promoter-driven VEGFA expression was induced by resveratrol (RSV) in MSCs, and in combination with known RSV biological functions, the protective effects of our approach were investigated by using ex vivo aortic ring coculture system and a 3D scaffolds in vivo model. Results of this investigation demonstrated that HSP promoter-driven VEGFA expression in MSC increased approximately 2-fold over the background VEGFA levels upon HSP70 promoter induction by RSV. Exposure of HUVEC cells to medium containing MSC in which VEGFA had been induced by cis-RSV enhanced tube formation in the treated HUVEC cells. RSV-treated MSC cells differentiated into endothelial-like phenotypes, exhibiting markedly elevated expression of endothelial cell markers. These MSCs also induced aortic ring sprouting, characteristic of neovascular formation from pre-existing vessels, and additionally promoted neovascularization at the MSC transplantation site in a mouse model. These observations support a hypothesis that VEGFA expression induced by cis-RSV acting on the HSP70 promoter in transplanted MSC augments the angiogenic effects of stem cell gene therapy. The use of an inducible system also vastly reduces possible clinical risks associated with constitutive VEGFA expression.

Oncostatin M-Preconditioned Mesenchymal Stem Cells Alleviate Bleomycin-Induced Pulmonary Fibrosis Through Paracrine Effects of the Hepatocyte Growth Factor

“…The hepatocyte growth factor (HGF) shRNA clone (TRCN0000336131; GGTAAAGGAGGCAGCTATAAA) targeted at the mouse HGF transcript was purchased from the National RNAi Core Facility, Academia Sinica (Taipei, Taiwan, http://rnai.genmed.sinica.edu.tw). Lentiviral constructs were generated by using three packaging plasmids—pMDLg/pRRE, CMV‐VSVG, and RSV‐Rev—in 293T cells, as described by Chen et al []. MSCs were treated with viral supernatant and polybrene for 24 hours before selection with 0.5 μg/ml puromycin.…”

“…tw). Lentiviral constructs were generated by using three packaging plasmids-pMDLg/pRRE, CMV-VSVG, and RSV-Rev-in 293T cells, as described by Chen et al [19]. MSCs were treated with viral supernatant and polybrene for 24 hours before selection with 0.5 mg/ml puromycin.…”

Beneficial action of resveratrol: How and why?

“…There are two other potential mechanims by which resveratrol acts: (i) by altering gut microbiota that have a role in several diseases and (ii) influencing stem cell proliferation and differentiation (52)(53)(54)(55).…”

Selaginella bryopteris Aqueous Extract Improves Stability and Function of Cryopreserved Human Mesenchymal Stem Cells

“…As a protective response to external stimuli, Hsps increase their expression, help to maintain the metabolic and structural integrity of the cells, and enable the cells to become more resistant to stress conditions [ 32 – 34 ]. It is also suggested that Hsps inhibit apoptotic cell death [ 32 ].…”

“…It is also suggested that Hsps inhibit apoptotic cell death [ 32 ]. Hsp70 [ 33 ] and Hsp90 [ 34 ] in combination or alone play a major role in morphogenesis and dimorphism [ 35 ]. Protein denaturation has been reported in stress conditions and during modulation in temperature, which causes native misfolded aggregation of proteins that ultimately leads to the loss of biological functions as well as apoptosis [ 36 ].…”