mEosFP-Based Green-to-Red Photoconvertible Subcellular Probes for Plants  

Abstract

Photoconvertible fluorescent proteins (FPs) are recent additions to the biologists' toolbox for understanding the living cell. Like green fluorescent protein (GFP), monomeric EosFP is bright green in color but is efficiently photoconverted into a red fluorescent form using a mild violet-blue excitation. Here, we report mEosFP-based probes that localize to the cytosol, plasma membrane invaginations, endosomes, prevacuolar vesicles, vacuoles, the endoplasmic reticulum, Golgi bodies, mitochondria, peroxisomes, and the two major cytoskeletal elements, filamentous actin and cortical microtubules. The mEosFP fusion proteins are smaller than GFP/red fluorescent protein-based probes and, as demonstrated here, provide several significant advantages for imaging of living plant cells. These include an ability to differentially color label a single cell or a group of cells in a developing organ, selectively highlight a region of a cell or a subpopulation of organelles and vesicles within a cell for tracking them, and understanding spatiotemporal aspects of interactions between similar as well as different organelles. In addition, mEosFP probes introduce a milder alternative to fluorescence recovery after photobleaching, whereby instead of photobleaching, photoconversion followed by recovery of green fluorescence can be used for estimating subcellular dynamics. Most importantly, the two fluorescent forms of mEosFP furnish bright internal controls during imaging experiments and are fully compatible with cyan fluorescent protein, GFP, yellow fluorescent protein, and red fluorescent protein fluorochromes for use in simultaneous, multicolor labeling schemes. Photoconvertible mEosFP-based subcellular probes promise to usher in a much higher degree of precision to live imaging of plant cells than has been possible so far using single-colored FPs.

FRIENDLY Regulates Mitochondrial Distribution, Fusion, and Quality Control in Arabidopsis

“…Exchange of matrix-localized mito-mEosFP (Mathur et al, 2010) was analyzed between mitochondria in the leaves of 14-d-old Arabidopsis seedlings. Pieces of detached leaf were mounted in water between a slide and a coverslip on a chambered slide made from two parallel strips of ultrathin double-sided adhesive tape (Ekanayake et al, 2014).…”

“…To test whether the increased rate of pulsing correlated with an increase in the extent of matrix mixing, and therefore intermitochondrial fusion, we devised a quantitative in vivo fusion assay using the mitochondriatargeted photoconvertible protein mito-monomeric (m)Eos (Mathur et al, 2010). Matrix-localized mEos was photoconverted within highly motile mitochondria in a region of leaf epidermis ( Fig.…”

“…Homozygous mutant plants (named friendly-3) were identified using the gene-specific LP (59-ATACCTGCAGCAGTTTGCAAC-39) and RP (59-CTAGCGCCAACAGCT-CTACTG-39) primers together with the left border T-DNA primer (LBb1), 59-GCGTGGACCGCTTGCTGCAACT-39. Homozygous friendly-3 mutants were crossed with lines expressing mito-GFP or mito-mEosFP (using the same targeting signal as mito-GFP but fused to mEOS; Mathur et al, 2010). Crossing was performed as described by Meyerowitz and Somerville (1994).…”

Molecular Mechanisms and Physiological Significance of Organelle Interactions and Cooperation

“…We generated a stable transgenic moss line constitutively expressing mitochondria-targeted mEOS (mtEOS; Mathur et al, 2010) and transiently transfected protoplasts of this line with an ER marker that comprises a signal peptide, mCerulean, and a C-terminal KDEL ER retention signal (spCerKDEL). We found that mitochondria in moss protoplasts were mostly small elongated tubular structures which move only at about a 10th of the speed of flowering plant mitochondria (max.…”

“…Mitochondria-targeted mEOS (Wiedenmann et al, 2004), containing the first 261 bp of the Nicotiana plumbaginifolia mitochondrial ATP2-1 coding sequence (X02868) as N-terminal targeting signal Mathur et al, 2010), was amplified via PCR (F ATAAGTCGACATGGCTTCTCGG AGGCTTCT, R ATCCGAGCTCTTATCGTCTGGCATTG) and ligated via the introduced SalI and SacI restriction sites into a newly assembled vector backbone containing the moss Actin5 promoter (Weise et al, 2006) and a NOS terminator, as well as homologous regions for gene targeting to the "P. patens targeting site 2" (PTA2; Kubo et al, 2013) locus (pAct5_PTA2). To assemble this vector, PTA2 5 ′ homologous region (F GCT CTTCTCCTGGGGATTAATTATTGGAGG, R GAAAGAACG AATTCGATCGGATCCGCGACTAGTGAGAGAATGTT) and PTA2 3 ′ homologous region (F CTAGTCGCGGATCCGAT CGAATTCGTTCTTTCTGTCATTAACTGG, R GCTCTTCAT TGTTCAGGATAATGGTTC) were amplified from genomic DNA, joined with two template PCR (Tian et al, 2004) and ligated into a pJET1.2 vector (Thermo Fisher Scientific).…”