Mechanism of Diol Dehydration by a Promiscuous Radical‐SAM Enzyme Homologue of the Antiviral Enzyme Viperin (RSAD2)

Abstract

has made ap rovisionalp atent application based on the discoveries demonstrated in this manuscript.Keywords: antiviral agents · nucleotide analogues · radical-SAM enzyme · tyrosyl radicals · viperin Figure 6. The proposed mechanism of catalysis by TtRSAD2. The 5'-dAdo radicalabstractst he Ha tom (red) at the C4' position of ribose to generate a C4'-centred radical intermediate. As ar esult of hyperconjugation between a po rbitalonC 4' and the s C3'ÀO3' orbital, assisted by ap rotein amino acid residue( AH), the 3'-OHg roupo ft he riboseforms awater molecule. The proton to generate the water molecule is provided by tyrosine either indirectly through ap roton hoppingp athway(1) or directly (2). Spontaneously, an electron from tyrosine reduces the substrate-radical intermediate. As a result, the nucleotide analogue product and ap rotein tyrosylradical are formed. The [4 FeÀ4S] 2 + clusteri sre-reduced and then,t he tyrosyl radicali s reducedbya ne lectron from the [4 FeÀ4S] + cluster.

ddhCTP produced by the radical‐SAM activity of RSAD2 (viperin) inhibits the NAD+‐dependent activity of enzymes to modulate metabolism

“…First, we measured whether a mixture of ddhCTP and 5′‐dA produced by the enzymatic activity of RSAD2 can inhibit the activity of GAPDH. To this end, we produced the mixture of ddhCTP and 5′‐dA using RSAD2 [21] (Methods). Then, the NAD + ‐dependent conversion of G3P to 1,3BPG by GAPDH was measured either directly or alternatively, using an enzyme‐coupled assay (Methods).…”

“…We have confirmed that the thermostable fungal RSAD2 from Thielavia terrestris (TtRSAD2) can efficiently catalyse transformation of CTP to ddhCTP [21]. Thus, to prepare a mixture of ddhCTP and 5′‐dA we used TtRSAD2.…”

“…To create an inactive variant of human RSAD2, the highly conserved Ser300 and Tyr301 were replaced by alanine and phenylalanine, respectively. Mutation of these residues in a fungal homologue of the enzyme fully abolishes the activity [21]. To create the double variant (DM‐RSAD2) of human RSAD2, the forward primer was 5’ CCAGAAGATGAAAGACGCCTTCCTTATTCTGGATG 3’ and the reverse primer was complementary to the forward primer.…”

“…How RSAD2 can have such broad cellular functions is unknown. It has been discovered that the radical‐SAM activity of vertebrate RSAD2 [20] and a fungal homologue of the enzyme [21] catalyses dehydration of cytidine triphosphate (CTP) to its analogue 3′‐deoxy‐3′,4′‐didehydro‐CTP (ddhCTP), while converting SAM to 5′‐deoxyadenosine (5′‐dA) (Fig. 1).…”

“…1). While human RSAD2 only catalyses transformation of CTP to ddhCTP, the fungal enzyme has substrate promiscuity [21]. Based on cell biological and biochemical assays, it is suggested that ddhCTP is a chain terminator of the RNA‐dependent RNA polymerases (RdRps) of a number of flaviviruses [20].…”