Measles virus causes immunogenic cell death in human melanoma

Donnelly, Oliver; Errington-Mais, Fiona; Steele, Lynette P.; Hadac, Elizabeth M.; Jennings, Victoria A.; Scott, Karen J.; Peach, Howard; Phillips, Roger M.; Bond, Jacquelyn; Pandha, Hardev; Harrington, Kevin; Vile, Richard G.; Russell, Stephen J.; Selby, Peter J.; Melcher, Alan

doi:10.1038/gt.2011.205

Cited by 151 publications

(141 citation statements)

References 61 publications

(80 reference statements)

Supporting

Mentioning

133

Contrasting

Order By: Relevance

“…113 Recent studies delineated that oncolytic viruses such as vaccinia, measles, HSV-2, and adenovirus cause the release of HMGB1. 64,65,114,115,116,117 Although HMGB1 interacts with viral components and may modulate viral replication, 117 the molecular mechanisms of how each oncolytic virus differentially produces these DAMPs remain largely elusive.…”

Section: Damps Induced By Infection With Oncolytic Virusesmentioning

confidence: 99%

Multimodal immunogenic cancer cell death as a consequence of anticancer cytotoxic treatments

2013

View full text Add to dashboard Cite

Apoptotic cell death generally characterized by a morphologically homogenous entity has been considered to be essentially non-immunogenic. However, apoptotic cancer cell death, also known as type 1 programmed cell death (PCD), was recently found to be immunogenic after treatment with several chemotherapeutic agents and oncolytic viruses through the emission of various danger-associated molecular patterns (DAMPs). Extensive studies have revealed that two different types of immunogenic cell death (ICD) inducers, recently classified by their distinct actions in endoplasmic reticulum (ER) stress, can reinitiate immune responses suppressed by the tumor microenvironment. Indeed, recent clinical studies have shown that several immunotherapeutic modalities including therapeutic cancer vaccines and oncolytic viruses, but not conventional chemotherapies, culminate in beneficial outcomes, probably because of their different mechanisms of ICD induction. Furthermore, interests in PCD of cancer cells have shifted from its classical form to novel forms involving autophagic cell death (ACD), programmed necrotic cell death (necroptosis), and pyroptosis, some of which entail immunogenicity after anticancer treatments. In this review, we provide a brief outline of the well-characterized DAMPs such as calreticulin (CRT) exposure, high-mobility group protein B1 (HMGB1), and adenosine triphosphate (ATP) release, which are induced by the morphologically distinct types of cell death. In the latter part, our review focuses on how emerging oncolytic viruses induce different forms of cell death and the combinations of oncolytic virotherapies with further immunomodulation by cyclophosphamide and other immunotherapeutic modalities foster dendritic cell (DC)-mediated induction of antitumor immunity. Accordingly, it is increasingly important to fully understand how and which ICD inducers cause multimodal ICD, which should aid the design of reasonably multifaceted anticancer modalities to maximize ICD-triggered antitumor immunity and eliminate residual or metastasized tumors while sparing autoimmune diseases.

show abstract

Section: Damps Induced By Infection With Oncolytic Virusesmentioning

confidence: 99%

Multimodal immunogenic cancer cell death as a consequence of anticancer cytotoxic treatments

2013

View full text Add to dashboard Cite

show abstract

“…Cassettes encoding antibodies against murine CTLA-4 (1584 bp) and PD-L1 (1596 bp), and the antibody constant region IgG1-Fc (864 bp) described previously 13 were excised from pCG vectors as MluI-PauI fragments and inserted into the MeVac genome in an ATU downstream the H ORF via the unique MauBI restriction site. The cassette encoding the murine IL-12 fusion protein (FmIL-12) consisting of murine IL-12 p40 and p35 subunits linked by a (Gly 3 Ser) 4 was generated based on results obtained by Lieschke et al…”

Section: Construction Of Recombinant Measles Virusesmentioning

confidence: 99%

“…3 Thus, virotherapy can be considered a type of immunotherapy. Different OVs have been shown to induce immunogenic cell death, [4][5][6][7] resulting in effective cross-presentation of tumor-associated antigens to T cells. 8 Nevertheless, it is unlikely that a single OV or other immunotherapies administered as single agents will be sufficient to eradicate advanced malignancies.…”

Section: Introductionmentioning

confidence: 99%

“…By additional PCRs p40 was flanked with an MluI site at the 5 0 end and with a 45 bp linker fragment at the 3 0 end using primers 5 0 -ACTAGTACGCGTGGCCACCATGTGT CCTCAGAAGCTAACCATCTCCTGGT-3 0 and 5 0 -CGACC CACCACCGCCCGAGCCACCGCCACCGGATCGGACCC TGCAGGGAACACATGCCCACTT-3 0 . The signal peptide at the 5 0 end of p35 was deleted and p35 was flanked with the (Gly 3 Ser) 4 linker at the 5 0 end, and a PauI restriction site at the 3 0 end by amplification with primers 5 0 -GGCGGTGGTGGGTCGGGTGGCGGCGGATCCAGGGT-CATTCCAGTCTCTGGACCTGCCAGGTGTCTT and 5 0 -AAAGTCGACTGCGCGCTATTATCAGGCGGAGCTCAGA-TAGCCCATCACCCT-3 0 . The modified p35 and p40 constructs were fused with primers flanking the 5 0 end of p40 and the 3 0 end of p35 in an overlap PCR to obtain the final FmIL-12 construct, which was cloned into pCG.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation

et al. 2017

View full text Add to dashboard Cite

Combination of oncolytic virotherapy with immunomodulators is emerging as a promising therapeutic strategy for numerous tumor entities. In this study, we developed measles Schwarz vaccine strain vectors encoding immunomodulators to support different phases in the establishment of antitumor immune responses. Therapeutic efficacy of the novel vectors was evaluated in the immunocompetent MC38cea tumor model. We identified vectors encoding an IL-12 fusion protein (MeVac FmIL-12) and an antibody against PD-L1 (MeVac anti-PD-L1), respectively, as the most effective. Treatment of established tumors with MeVac FmIL-12 achieved 90% complete remissions. Profiling of the tumor immune microenvironment revealed activation of a type 1 T helper cell-directed response, with MeVac FmIL-12 ensuring potent early natural killer and effector T cell activation as well as upregulation of the effector cytokines IFN-g and TNF-a. CD8C T cells were found to be essential for the therapeutic efficacy of MeVac FmIL-12. Results of this study present MeVac FmIL-12 as a novel approach for targeted IL-12 delivery and elucidate mechanisms of successful immunovirotherapy.

show abstract

“…3 Furthermore, it is believed that the immunogenic cell death in the tumor microenvironment that occurs because of oncolytic virus infection triggers release of damage-associated molecular pattern and pathogen-associated molecular pattern molecules, as well as inflammatory cytokines, that aid in the activation and recruitment of antigen presenting cells, ultimately yielding a Th1 immune response. 4 An essential factor in such immune therapeutic strategies is the idea that the tumor microenvironment acts as the center for tumor immune escape and regulation of anti-tumor immune responses ( Figure 1a). Multiple cytokines produced by tumor, particularly IL-10, can have pivotal roles in suppressing the immune response.…”

mentioning

confidence: 99%