Maternal Transmisson of HTLV‐1 Other than through Breast Milk: Discrepancy between the Polymerase Chain Reaction Positivity of Cord Blood Samples for HTLV‐1 and the Subsequent Seropositivity of Individuals

Abstract

We used a nested polymerase chain reaction (PCR) to diagnose HTLV‐1 carriers. The DNA isolated from the nuclear extract obtained from frozen whole blood was found appropriate for PCR study both qualitatively and quantitatively. The use of freshly frozen whole blood made the field work much easier, and the use of a nuclear extraction procedure allowed DNA isolation in just 4 microcentrifuge tubes. We could not attain sufficient sensitivity to detect a single molecule with single‐step PCR, but nested PCR was confirmed to detect a single molecule/reaction. All samples of the seropositive group including 94 blood donors, 66 mothers, and 13 children were positive in the nested PCR, while none of the seronegative group, including 198 blood donors and 285 children, was positive. Although 18/717 (2.5%) cord blood samples obtained from babies born to carrier mothers were PCR‐positive, none of 5 formula‐fed children tested who had been PCR‐positive in the cord blood gave evidence of infection later on. Furthermore, all of 4 seropositive infected children who were formula‐fed had been PCR‐negative in their cord blood. The results are not consistent with intrauterine infection, but suggest the presence of a perinatal or postnatal infection route other than through breast milk.

Lymphoid Organs as a Major Reservoir for Human T-Cell Leukemia Virus Type 1 in Experimentally Infected Squirrel Monkeys (Saimiri sciureus): Provirus Expression, Persistence, and Humoral and Cellular Immune Responses

“…Genomic DNA was extracted from PBMCs and various organs by the method described by Ibrahim et al (11). PCR (35 cycles) was performed, as previously described, with primers Rmtax1 and Rmtax2 (antisense) for the tax region (202 nucleotides) (23) and with primers gag1 and gag2 for the gag region (17). One microgram of genomic DNA from the PBMCs or organs was used for each PCR amplification.…”

Serological, Epidemiological, and Molecular Differences between Human T-Cell Lymphotropic Virus Type 1 (HTLV-1)-Seropositive Healthy Carriers and Persons with HTLV-I Gag Indeterminate Western Blot Patterns from the Caribbean

“…Briefly, each reaction tube contained 1 g of DNA, 0.2 mM deoxynucleoside triphosphate mixture (Boehringer GmbH, Mannheim, Germany), 5 l of 10ϫ reaction buffer (Perkin-Elmer Cetus, Norwalk, Conn.), 0.25 M (each) oligonucleotide primer (Pharmacia, Piscataway, N.J.), 2.5 mM MgCl 2 (Perkin-Elmer Cetus), and 2.5 U of Taq DNA polymerase (Perkin-Elmer Cetus) in a total volume of 50 l. The sequences of HTLV-1-and -2-specific primers and appropriate probes were as previously described (26). The primers and probes were as follows: pol region, primers SK110 and SK111 amplifying both HTLV-1 and HTLV-2 and probes SK112 for HTLV-1 and SK188 for HTLV-2; gag region, HTLV-1-specific primers GAG1 and GAG2 and probe GAGS (17); tax region, primers KKPX1 and KKPX2 amplifying both HTLV-1 and HTLV-2 and probes KKPXs (HTLV-1 specific) and SK45 (HTLV-1 and HTLV-2) (25). Housekeeping gene ␤-globin was studied to ensure that all extracted DNAs were amplifiable using primers PCO4 and GH20 (26).…”

Immunogenicity and Protective Efficacy of Recombinant Human T-Cell Leukemia/Lymphoma Virus Type 1 NYVAC and Naked DNA Vaccine Candidates in Squirrel Monkeys (Saimiri sciureus)

“…We also tested genomic DNA extracted from PBMCs for the presence of HTLV-1 sequences, as described by Ibrahim et al (16). PCR was performed as previously described with the gag-specific primers gag1 and gag2 (19) or the pol-specific primers SK54 and PolAG2 (16). The amplified products were subjected to electrophoresis in a 1.4% agarose gel, transferred to nylon membranes, and hybridized with 32 Plabeled internal oligonucleotide probes specific for the gag (5Ј GCAAAGGTA CTGCAGGAGGT 3Ј ) and pol (5Ј TTCCAGCCCTACTTTGCTTTCACTGT CCC 3Ј ) sequences.…”