Maternal and Zygotic aldh1a2 Activity Is Required for Pancreas Development in Zebrafish

Abstract

We have isolated and characterized a novel zebrafish pancreas mutant. Mutant embryos lack expression of isl1 and sst in the endocrine pancreas, but retain isl1 expression in the CNS. Non-endocrine endodermal gene expression is less affected in the mutant, with varying degrees of residual expression observed for pdx1, carbA, hhex, prox1, sid4, transferrin and ifabp. In addition, mutant embryos display a swollen pericardium and lack fin buds. Genetic mapping revealed a mutation resulting in a glycine to arginine change in the catalytic domain of the aldh1a2 gene, which is required for the production of retinoic acid from vitamin A. Comparison of our mutant (aldh1a2um22) to neckless (aldh1a2i26), a previously identified aldh1a2 mutant, revealed similarities in residual endodermal gene expression. In contrast, treatment with DEAB (diethylaminobenzaldehyde), a competitive reversible inhibitor of Aldh enzymes, produces a more severe phenotype with complete loss of endodermal gene expression, indicating that a source of Aldh activity persists in both mutants. We find that mRNA from the aldh1a2um22 mutant allele is inactive, indicating that it represents a null allele. Instead, the residual Aldh activity is likely due to maternal aldh1a2, since we find that translation-blocking, but not splice-blocking, aldh1a2 morpholinos produce a phenotype similar to DEAB treatment. We conclude that Aldh1a2 is the primary Aldh acting during pancreas development and that maternal Aldh1a2 activity persists in aldh1a2um22 and aldh1a2i26 mutant embryos.

Somite-Derived Retinoic Acid Regulates Zebrafish Hematopoietic Stem Cell Formation

“…Transgenic fish lines used in experiments include Tg ( gata1 : DsRed ) sd2Tg [29], and Tg ( kdrl : GFP ) la116Tg [30]. Aldehyde dehydrogenase 1 family, member A2 (Aldh1a2)-depleted embryos were generated by injecting one-cell AB embryos with 5 ng of translation-blocking aldh1a2 morpholino oligonucleotide (MO; Gene Tools); GCAGTTCAACTTCACTGGAGGTCAT, as previously described [17]. …”

“…Unlike mice, Aldh1a2-depleted zebrafish survive up to five days post fertilization (dpf) [17]. Zebrafish HSC emergence occurs by 30 hours post fertilization (hpf), making zebrafish an ideal model to study the role of RA in definitive hematopoiesis.…”

The negative side of retinoic acid receptors

“…As a hypothesis it is expected to be challenged. For example, in a recent publication (Alexa K, et al 2009) a series of experiments suggest strongly that raldh2 mRNA is maternally inherited and functional at some time during embryogenesis. Its message was detectable in 3 hour, post-fertilization embryos.…”

Nuclear receptor research in zebrafish

“…However, the hindbrain phenotype was less severe than observed in these other models, which was explained by maternal Aldh1a2 activity. This was demonstrated in a study in which two aldh1a2 morpholinos were compared (Alexa et al 2009): a translation-blocking morpholino (affecting expression from all mRNAs) which induced a similar phenotype as chemical inhibition of Aldh1a2, and a splice-blocking morpholino (affecting expression form only zygotic mRNAs) which displayed a less severe phenotype. Morpholino knockdown of the expression of another enzyme of this subfamily, Aldh1a3, did not result in hindbrain defects, but aberrant eye development was observed (Yahyavi et al 2013).…”