Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat ( Triticum aestivum L.) genome

Abstract

More than 50 leaf rust resistance (Lr) genes against the fungal pathogen Puccinia triticina have been identified in the wheat gene pool, and a large number of them have been extensively used in breeding. Of the 50 Lr genes, all are known only from their phenotype and͞or map position except for Lr21, which was cloned recently. For many years, the problems of molecular work in the large (1.6 ؋ 10 10 bp), highly repetitive (80%), and hexaploid bread wheat (Triticum aestivum L.) genome have hampered map-based cloning. Here, we report the isolation of the Lr gene Lr10 from hexaploid wheat by using a combination of subgenome map-based cloning and haplotype studies in the genus Triticum. Lr10 is a single-copy gene on chromosome 1AS. It encodes a CC-NBS-LRR type of protein with an N-terminal domain, which is under diversifying selection. When overexpressed in transgenic wheat plants, Lr10 confers enhanced resistance to leaf rust. Lr10 has similarities to RPM1 in Arabidopsis thaliana and to resistance gene analogs in rice and barley, but is not closely related to other wheat Lr genes based on Southern analysis. We conclude that map-based cloning of genes of agronomic importance in hexaploid wheat is now feasible, opening perspectives for molecular bread wheat improvement trough transgenic strategies and diagnostic allele detection.

Rapid linkage disequilibrium decay in the Lr10 gene in wild emmer wheat (Triticum dicoccoides) populations

“…DNA was extracted from 10-day-old seedlings using ArchivePure DNA extraction kit (5 prime). The whole Lr10 gene (4 kb) was amplified using Pfu Ultra Fusion II HS polymerase (Stratagene) according to the supplier's protocol (annealing temperature was 53 o C and elongation time of 1 min) with the primers ThLR10_V (CGGAACTATGGAGAGTGAAC) and ThLR10_U (GGGAAATGTAGACAGGTACAT) (Feuillet et al 2003).…”

“…Within-population nucleotide diversity for coding regions was calculated for nine populations that were represented by at least three accessions in the alignment. Previous studies have shown that the CC domain is the most diverse region of the Lr10 (Feuillet et al 2003;Loutre et al 2009). Therefore, the analysis was conducted on the CC domain and on the NBS-LRR domains separately.…”

“…Lr10 encodes a three domain protein: coiled-coil, nucleotide binding site and leucine rich repeats (CC-NBS-LRR) (Feuillet et al 2003). Lr10 is located 36 cM from the centromere on the short arm of chromosome 1A.…”

Fine mapping and characterization of Sr21, a temperature-sensitive diploid wheat resistance gene effective against the Puccinia graminis f. sp. tritici Ug99 race group

“…Bradi5g22140, Bradi5g22150, Bradi5g22160 and Bradi5g22180 are interesting candidate genes since they are annotated as typical plant disease resistance genes which encode proteins carrying a coiled-coil domain (predicted by COILS WEB site), a nucleotide-binding site (NBS, AAA superfamily), and leucine-reach repeat (LRR) domains (also referred as resistance gene analogs RGA). NBS-LRR genes are the most frequent class found among cloned disease resistance genes in cereals and other plant species (Feuillet et al 2003;Periyannan et al 2013;Saintenac et al 2013). A cluster of NBS-LRR resistance genes was found also in the corresponding colinear region in rice suggesting that an ancient cluster of resistance genes is present in this chromosome region in grass genomes and is likely to be present in wheat.…”

Mapping of the leaf rust resistance gene Lr38 on wheat chromosome arm 6DL using SSR markers

“…So far, more than 50 leaf rust resistance genes have been described (McIntosh et al 1995(McIntosh et al , 2005. However, only two leaf rust resistance genes, Lr10 and Lr21, have been cloned so far (Feuillet et al 2003;Huang et al 2003). Both genes are typical NBS-LRR type resistance genes.…”