Mannose Receptor Ligand-Positive Cells Express the Metalloprotease Decysin in the B Cell Follicle

Abstract

Decysin, a gene encoding a disintegrin metalloprotease, is transcribed in human dendritic cells (DC) and germinal centers (GC). We have cloned its murine homologue and show that it is processed by the endoprotease furin before secretion of the catalytic domain. We have defined the cell types that express decysin in mouse spleen in the course of an immune response to T cell-dependent Ags. Like in humans, decysin is transcribed by activated CD11c+ DC that enter the T cell zone from the marginal zone (MZ). In the GC, decysin is expressed by follicular DC and tingible body macrophages. In addition, a MZ cell population expresses decysin and appears to migrate into the B cell follicle. The majority of these follicle-homing cells express the mannose receptor ligand, a marker for the macrophage-like MZ metallophils. The follicle-homing cells are M-CSF dependent, as they are absent in op/op mice that lack functional M-CSF. This suggests that mannose receptor ligand+ MZ metallophils differentiate into cells that migrate from the MZ into the B cell follicle. Decysin represents the first marker for this previously unrecognized cell population of the mouse spleen, which may represent a precursor for GCDC and may be specialized in the transport of unprocessed Ag from the MZ into developing GC.

ADAMDEC1 Is a Metzincin Metalloprotease with Dampened Proteolytic Activity

“…Our findings confirm processing of human ADAMDEC1 at RISR 203 -SLKS consistent with furinlike proprotein convertase activity. In comparison, murine ADAMDEC1 contains two proprotein convertase-like recognition sites, RDQR 156 and RTSR 203 , where in vitro furin processing at the latter site was demonstrated to generate the mature protein (11). Moreover, we demonstrate that full-length pro-ADAMDEC1 has reduced proteolytic activity, and thus the prodomain maintains partial catalytic latency of the protease.…”

“…Indeed, furin has been shown in vitro to be capable of processing the prodomain in the murine ortholog (11). The mature protein only comprises a metzincin metalloprotease domain and a short disintegrin-like domain.…”

Splenic Marginal Zone Dendritic Cells Mediate the Cholera Toxin Adjuvant Effect: Dependence on the ADP-Ribosyltransferase Activity of the Holotoxin

“…The final concentration of the conjugates was assessed by GM1 ganglioside ELISA against a standard preparation of CT or CTB (30). The relative OVA content in the conjugates was assessed by rabbit anti-OVA Abs and anti-rabbit Ig-HRP Abs using the GM1 ganglioside ELISA (30). The molar ratio of OVA to CT or CTB was always 4:1.…”

“…The CT/CTB-SPDP and OVA-SPDP were mixed at room temperature for 24 h, dialyzed against PBS, and concentrated on a centrifuge column. The final concentration of the conjugates was assessed by GM1 ganglioside ELISA against a standard preparation of CT or CTB (30). The relative OVA content in the conjugates was assessed by rabbit anti-OVA Abs and anti-rabbit Ig-HRP Abs using the GM1 ganglioside ELISA (30).…”

Evidence for Restricted Reactivity of ADAMDEC1 with Protein Substrates and Endogenous Inhibitors

“…cDNA encoding murine ADAMDEC1 was purchased from ImaGenes (Berlin, Germany) and cloned into a pCI-neo vector (Promega) using a forward (tacgactcactataggctagcatgctgcctgggact) and reverse (cctcactaaagggaagcggccgctcattctgtgatgtgg) primer. An HPC4 affinity tag inserted 2 amino acids downstream of the furin recognition site (RTSR 203 (4)) was created by overlap extension PCR using two internal primers: cttcatttgggttttttttgccatcaatcagacgcggatccacc and gaacttccaggtcactcgaagatcaggtggatccgcgtctgattg. Site-directed mutagenesis of C392S in hADAMDEC1 was carried out using the QuikChange XL site-directed mutagenesis kit (Agilent Technologies) with mutagenesis primers (ggacttcagcacaagctccagagcccacttcgag and the reverse complementary primer).…”