Manganese-induced turnover of TMEM165

Potelle, Sven; Dulary, Eudoxie; Climer, Leslie K.; Duvet, Sandrine; Morelle, Willy; Vicogne, Dorothée; Lebredonchel, Elodie; Houdou, Marine; Spriet, Corentin; Krzewinski-Recchi, Marie-Ange; Péanne, Romain; Klein, André; Bettignies, Geoffroy de; Morsomme, Pierre; Matthijs, Gert; Marquardt, Thorsten; Lupashin, Vladimir; Foulquier, François

doi:10.1042/bcj20160910

Cited by 48 publications

(63 citation statements)

References 29 publications

(25 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although the central loops vary in length between 31 amino acids (in AtPAM71) and 61 amino acids (in ScGDT1), they all contain several acidic residues. 1,9,11 Two highly conserved E-x-G-D-(KR)-(TS) motifs are found in transmembrane domains TM1 and TM4, each which 2 negatively charged acidic residues. Together, these features Figure 1.…”

Section: Structural Similarity Of Atpam71 With Other Upf0016 Family Mmentioning

confidence: 99%

“…Lactobacillales and Bacillales). 1 The most prominent representative members of this family are ScGDT1 from yeast, 2,3 HsTMEM165 from human [4][5][6][7][8][9][10] and AtPAM71 ( D AtCCHA1) from Arabidopsis. 11,12 ScGDT1 (GCR1 DEPENDENT TRANSLATION FACTOR 1) contributes to Ca 2C homeostasis in yeast via an uncharacterized Ca 2C transport pathway localized in the Golgi apparatus.…”

mentioning

confidence: 99%

“…Furthermore, it was shown that the yeast gdt1 strain was affected in N-glycosylation under high calcium concentrations, and that 1 mM MnCl 2 was sufficient to completely suppress the glycosylation deficiency seen under this condition. 3,9 A recent study in Arabidopsis characterized the function of a plant member of the UPF0016 family, AtPAM7. 11 The pam71 mutant plants were found impaired in photosynthesis with a primary defect in photosystem II (PSII).…”

mentioning

confidence: 99%

See 2 more Smart Citations

Plants contain small families of UPF0016 proteins including the PHOTOSYNTHESIS AFFECTED MUTANT71 transporter

Hoecker

Leister

Schneider

2017

Plant Signaling & Behavior

View full text Add to dashboard Cite

PHOTOSYNTHESIS AFFECTED MUTANT71 (PAM71) is an integral thylakoid membrane protein that functions in manganese uptake into the lumen. Manganese is needed in the thylakoid lumen to build up the inorganic MnCaO cluster, the catalytic center for water oxidation, and is hence indispensable for oxygen evolution. A recent study revealed that PAM71 is well conserved in plants and shares homology to GCR1 DEPENDENT TRANSLATION FACTOR1 (GDT1) and TRANSMEMBRANE PROTEIN 165 (TMEM165) in Saccharomyces cerevisiae and Homo sapiens, respectively. In most eukaryotes only single members of this family, designated "Uncharacterized Protein Family 0016" (UPF0016), are present; however, plant genomes contain genes for several UPF0016 proteins. In Arabidopsis thaliana, this protein family comprises 5 members, which mainly differ in their N-terminal regions. PAM71 and its closest homolog PAM71-HL possess chloroplast transit peptides at their N-terminus. Two of the remaining 3 members are derived from a segmental chromosomal duplication event and lack an N-terminal extension. Thus, plants have evolved UPF0016 members residing in various compartments of the cell, whereas in non-plant eukaryotes just a Golgi localization occurs. The identification of PAM71 as a candidate Mn transporter opens the question on the function of the remaining plant members. Here we resume briefly our current knowledge of UPF0016 members in Arabidopsis in comparison to their yeast and human UPF0016 members.

show abstract

Section: Structural Similarity Of Atpam71 With Other Upf0016 Family Mmentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Plants contain small families of UPF0016 proteins including the PHOTOSYNTHESIS AFFECTED MUTANT71 transporter

Hoecker

Leister

Schneider

2017

Plant Signaling & Behavior

View full text Add to dashboard Cite

show abstract

“…Mn supplementation in cultured cells and galactose supplementation in human patients can rescue phenotypes associated with defects in TMEM165 (Morelle et al 2017; Potelle et al 2017). COG, as an interaction hub for Golgi and endosomal trafficking machinery, may require compound therapies to correct multiple defects.…”

Section: Discussion and Perspectivementioning

confidence: 99%

Conserved Oligomeric Golgi and Neuronal Vesicular Trafficking

Climer

Hendrix²,

Lupashin

2017

Targeting Trafficking in Drug Development

View full text Add to dashboard Cite

The conserved oligomeric Golgi (COG) complex is an evolutionary conserved multi-subunit vesicle tethering complex essential for the majority of Golgi apparatus functions: protein and lipid glycosylation and protein sorting. COG is present in neuronal cells, but the repertoire of COG function in different Golgi-like compartments is an enigma. Defects in COG subunits cause alteration of Golgi morphology, protein trafficking, and glycosylation resulting in human congenital disorders of glycosylation (CDG) type II. In this review we summa rize and critically analyze recent advances in the function of Golgi and Golgi-like compartments in neuronal cells and functions and dysfunctions of the COG complex and its partner proteins.

show abstract

“…Control and TMEM165 KO HEK/HeLa‐GalT cells were generated as previously described in Reference . Briefly, TMEM165 was knocked out using CRISPR/Cas9‐mediated deletion with guide RNAs targeting the first exon (target sequence: TCCAGGGAACGGCCGCGCAT).…”

Section: Methodsmentioning

confidence: 99%

Fetal bovine serum impacts the observed N‐glycosylation defects in TMEM165 KO HEK cells

Vicogne

Houdou

Garat

et al. 2019

J of Inher Metab Disea

Self Cite

View full text Add to dashboard Cite

TMEM165 is involved in a rare genetic human disease named TMEM165‐CDG (congenital disorders of glycosylation). It is Golgi localized, highly conserved through evolution and belongs to the uncharacterized protein family 0016 (UPF0016). The use of isogenic TMEM165 KO HEK cells was crucial in deciphering the function of TMEM165 in Golgi manganese homeostasis. Manganese is a major cofactor of many glycosylation enzymes. Severe Golgi glycosylation defects are observed in TMEM165 Knock Out Human Embryonic Kidney (KO HEK) cells and are rescued by exogenous manganese supplementation. Intriguingly, we demonstrate in this study that the observed Golgi glycosylation defect mainly depends on fetal bovine serum, particularly its manganese level. Our results also demonstrate that iron and/or galactose can modulate the observed glycosylation defects in TMEM165 KO HEK cells. While isogenic cultured cells are widely used to study the impact of gene defects on proteins' glycosylation patterns, these results emphasize the importance of the use of validated fetal bovine serum in glycomics studies.

show abstract

Manganese-induced turnover of TMEM165

Cited by 48 publications

References 29 publications

Plants contain small families of UPF0016 proteins including the PHOTOSYNTHESIS AFFECTED MUTANT71 transporter

Plants contain small families of UPF0016 proteins including the PHOTOSYNTHESIS AFFECTED MUTANT71 transporter

Conserved Oligomeric Golgi and Neuronal Vesicular Trafficking

Fetal bovine serum impacts the observed N‐glycosylation defects in TMEM165 KO HEK cells

Contact Info

Product

Resources

About