Mammary Epithelial Reconstitution with Gene-Modified Stem Cells Assigns Roles to Stat5 in Luminal Alveolar Cell Fate Decisions, Differentiation, Involution, and Mammary Tumor Formation

Vafaizadeh, Vida; Klemmt, Petra; Brendel, Christian; Weber, Kristoffer; Doebele, Carmen; Britt, Kara; Grez, Manuel; Fehse, Boris; Desrivières, Sylvane; Groner, Bernd

doi:10.1002/stem.407

Cited by 74 publications

(81 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…36, 37; (reviewed in refs. 34, 38)] and by MPA (15,(39)(40)(41), focusing on STAT5 which plays a role in mammary tum origenesis (11,13) and in progesterone-mediated effects on the normal mammary gland (16,26). We report that FGF2 and MPA induced ERK, AKT, and STAT5 activation, in agreement with a recent report showing that FGF2 activates STAT5 in endothelial cells by a SRC-and JAK2-dependent mechanism (6).…”

Section: Discussionsupporting

confidence: 89%

“…Constitutively activated forms of STAT3 and STAT5 have been observed in tumor-derived cell lines and human cancer (12). The overexpression of STAT5 has been shown to increase mammary carcinogenesis (13). Also, a clear cross talk between growth factors that input to STAT5 and PR on genes containing GAS sequences has been shown in human breast cancer cells (14,15).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Interaction between FGFR-2, STAT5, and Progesterone Receptors in Breast Cancer

et al. 2011

View full text Add to dashboard Cite

Fibroblast growth factor (FGF) receptor 2 (FGFR-2) polymorphisms have been associated with an increase in estrogen receptor and progesterone receptor (PR)-positive breast cancer risk; however, a clear mechanistic association between FGFR-2 and steroid hormone receptors remains elusive. In previous works, we have shown a cross talk between FGF2 and progestins in mouse mammary carcinomas. To investigate the mechanisms underlying these interactions and to validate our findings in a human setting, we have used T47D human breast cancer cells and human cancer tissue samples. We showed that medroxyprogesterone acetate (MPA) and FGF2 induced cell proliferation and activation of ERK, AKT, and STAT5 in T47D and in murine C4-HI cells. Nuclear interaction between PR, FGFR-2, and STAT5 after MPA and FGF2 treatment was also showed by confocal microscopy and immunoprecipitation. This effect was associated with increased transcription of PRE and/or GAS reporter genes, and of PR/STAT5-regulated genes and proteins. Two antiprogestins and the FGFR inhibitor PD173074, specifically blocked the effects induced by FGF2 or MPA respectively. The presence of PR/FGFR-2/ STAT5 complexes bound to the PRE probe was corroborated by using NoShift transcription and chromatin immunoprecipitation of the MYC promoter. Additionally, we showed that T47D cells stably transfected with constitutively active FGFR-2 gave rise to invasive carcinomas when transplanted into NOD/SCID mice. Nuclear colocalization between PR and FGFR-2/STAT5 was also observed in human breast cancer tissues. This study represents the first demonstration of a nuclear interaction between FGFR-2 and STAT5, as PR coactivators at the DNA progesterone responsive elements, suggesting that FGFRs are valid therapeutic targets for human breast cancer treatment. Cancer Res; 71(10); 3720-31. Ó2011 AACR.

show abstract

Section: Discussionsupporting

confidence: 89%

Section: Introductionmentioning

confidence: 99%

Interaction between FGFR-2, STAT5, and Progesterone Receptors in Breast Cancer

et al. 2011

View full text Add to dashboard Cite

show abstract

“…Stat5a signaling induced by myoepithelial cell-derived neuregulin 1 (Nrg1) is also necessary for MaSC activity (Vafaizadeh et al, 2010;Forster et al, 2014). Nrg1 is expressed in myoepithelial cells in a p63-dependent manner and is detected by luminal cells via the Erbb4 receptor.…”

Section: Luminal Progenitor Cell Differentiationmentioning

confidence: 99%

Mammary gland development: cell fate specification, stem cells and the microenvironment

et al. 2015

View full text Add to dashboard Cite

The development of the mammary gland is unique: the final stages of development occur postnatally at puberty under the influence of hormonal cues. Furthermore, during the life of the female, the mammary gland can undergo many rounds of expansion and proliferation. The mammary gland thus provides an excellent model for studying the 'stem/progenitor' cells that allow this repeated expansion and renewal. In this Review, we provide an overview of the different cell types that constitute the mammary gland, and discuss how these cell types arise and differentiate. As cellular differentiation cannot occur without proper signals, we also describe how the tissue microenvironment influences mammary gland development.

show abstract

“…Oligonucleotide pairs for shKit1 (CACCGCCTTCCCTTGTTTGGCAAAGCGAA CTTTGCCAAACAAGGGAAGGC and AAAAGCCTTCC CTTGTTTGGCAAAGTTCGCTTTGCCAAACAAGGGAA GGC) and shKit2 (CACCGCAGAAGCGGCACTTTATAA GCGAACTTATAAAGTGCCGCTTCTGC and AAAAGC AGAAGCGGCACTTTATAAGTTCGCTTATAAAGTGCC GCTTCTGC) were ligated into pENTR/U6 Gateway system entry vector (Invitrogen) according to manufacturer's instructions. Hairpin sequences were verified and then transferred, together with the U6 promoter, into a Gateway-modified pSEW lentiviral vector backbone (Vafaizadeh et al, 2010) by LR reaction (Invitrogen).…”

Section: Lentivirus Productionmentioning

confidence: 99%

c-Kit is required for growth and survival of the cells of origin of Brca1-mutation-associated breast cancer

et al. 2011

View full text Add to dashboard Cite

BRCA1 mutation-associated breast cancer originates in oestrogen receptor-alpha-negative (ER À ) progenitors in the mammary luminal epithelium. These cells also express high levels of the Kit gene and a recent study demonstrated a correlation between Brca1 loss and Kit over-expression in the mammary epithelium. However, the functional significance of c-Kit expression in the mammary gland is unknown. To address this, c-Kit À and c-Kit þ mammary epithelial subsets were isolated by flow cytometry, characterised for expression of lineage-specific cell markers and functionally analysed by in vitro colony forming and in vivo transplantation assays. The results confirm that the majority of luminal ER À progenitors are c-Kit þ , but also that most stem cells and the differentiated cell populations are c-Kit À . A subset of c-Kit þ cells with high proliferative potential was found in the luminal ER þ population, however, suggesting the existence of a distinct luminal ER þ progenitor cell type. Analysis of mouse Brca1 mammary tumours demonstrated that they expressed Kit and its downstream effector Lyn at levels comparable to the most strongly c-Kit þ luminal ER À progenitors. Consistent with c-Kit being a progenitor cell marker, in vitro threedimensional differentiation of c-Kit þ cells resulted in a loss of c-Kit expression, whereas c-Kit over-expression prevented normal differentiation in vivo. Furthermore, c-Kit was a functional marker of proliferative potential, as c-Kit inhibition by short hairpin knockdown prevented normal epithelial growth and caused cells to undergo apoptosis. Therefore, c-Kit defines distinct progenitor populations in the mammary epithelium and is critical for mammary progenitor survival and proliferation. Importantly, c-Kit is only the second mammary epithelial stem/progenitor marker to be shown to have a functional role in the mammary epithelium and the first marker to be shown to be required for progenitor cell function. The c-Kit signalling network has potential as a target for therapy and/or prevention in BRCA1-associated breast cancer.

show abstract

Mammary Epithelial Reconstitution with Gene-Modified Stem Cells Assigns Roles to Stat5 in Luminal Alveolar Cell Fate Decisions, Differentiation, Involution, and Mammary Tumor Formation

Cited by 74 publications

References 47 publications

Interaction between FGFR-2, STAT5, and Progesterone Receptors in Breast Cancer

Interaction between FGFR-2, STAT5, and Progesterone Receptors in Breast Cancer

Mammary gland development: cell fate specification, stem cells and the microenvironment

c-Kit is required for growth and survival of the cells of origin of Brca1-mutation-associated breast cancer

Contact Info

Product

Resources

About