Making Drosophila lineage–restricted drivers via patterned recombination in neuroblasts

Abstract

The Drosophila cerebrum originates from about 100 neuroblasts per hemisphere, with each neuroblast producing a characteristic set of neurons. Neurons from a neuroblast are often so diverse that many neuron types remain unexplored. We developed new genetic tools that target neuroblasts and their diverse descendants, increasing our ability to study fly brain structure and development. Common enhancer-based drivers label neurons on the basis of terminal identities rather than origins, which provides limited labeling in the heterogeneous neuronal lineages. We successfully converted conventional drivers that are temporarily expressed in neuroblasts, into drivers expressed in all subsequent neuroblast progeny. One technique involves immortalizing GAL4 expression in neuroblasts and their descendants. Another depends on loss of the GAL4 repressor, GAL80, from neuroblasts during early neurogenesis. Furthermore, we expanded the diversity of MARCM-based reagents and established another site-specific mitotic recombination system. Our transgenic tools can be combined to map individual neurons in specific lineages of various genotypes.

Transcriptomes of lineage-specific Drosophila neuroblasts profiled via genetic targeting and robotic sorting

“…To achieve permanent NB labeling we engineered recombinase-dependent NB drivers in which a chimeric dpnEE promoter (active in all cerebral NBs) is separated from an exogenous transcriptional activator (GAL4 or LexA::P65) (Awasaki et al, 2014) by a site-specific recombination cassette carrying transcription/translation stop signals (Pfeiffer et al, 2010). Only in dpnEE-active cells can excision of the intervening cassette lead to activation of the driver.…”

“…1). However, most isolated cis-regulatory elements show not only high activities in some restricted patterns but also weaker expression in other, often larger, domains (Awasaki et al, 2014). Such low-level 'background' activities could activate the recombinase-dependent NB driver in many more NBs at low frequencies, and drastically reduce the targeting specificity of otherwise sparse NB drivers.…”

“…1A-C). To exclusively label the four major AL NBs (ALad1, ALl1, ALv1 and ALv2), we first drove a recombinase with R44F03 (Awasaki et al, 2014), which confined the pan-NB driver primarily to the AL. Then we used another characterized AL promoter, ems (Lichtneckert et al, 2008;Lin et al, 2013), to drive a second recombinase for activation of the GFP reporter only in the AL NBs (Fig.…”

An Enhanced Gene Targeting Toolkit forDrosophila: Golic+

“…Additionally, to reduce similarity and chances of recombination between sequences, we ordered a Drosophila codon-optimized coding sequence of Rac1 V12 (GeneArt; Invitrogen, Carlsbad, CA) and created the nonrepressible 5XLexAop2-opRac1 V12 -hsp70T (NotI/XbaI). rCD2 miRNA 6 was cloned into pMLH (NotI/XhoI) (Awasaki et al 2014) to make lexAop-rCD2i. pTL1 (targeting with lethality selection), pTL2, Pfife (p10-facilitated indicators of flip excision), and BPfife were constructed following traditional molecular cloning and assembled from smaller DNA fragments.…”

“…nSyb-LexA::p65 is a neuronal synaptobrevin promoter-fusion LexA::p65 (Pfeiffer et al 2010;Awasaki et al 2014) construct created as the essential (neuronal) driver to implement the larval/pupal lethal selection of Golic+. To create bamP-Cas9-2A-FLP-2A-I-SceI, bam 39-UTR was cloned from BACR06L08 into pJFRC28 (KpnI/EcoRI) with primers (GGGGTACCTCTAGACTAATGCTGTGCACATCGATAAAAG and GGAATTCAGTCCAAACACAAATCGTAAATATTTATTTG).…”