Maf nuclear oncoprotein recognizes sequences related to an AP-1 site and forms heterodimers with both Fos and Jun.

Abstract

The v-maf oncogene, identified from AS42 avian retrovirus, encodes a nuclear bZip protein. To elucidate the molecular mechanism of cell transformation induced by this oncogene, we determined the specific binding sequences of its product. Maf protein recognized two types of relatively long palindromic consensus sequences, TGCTGACTCAGCA and TGCTGACGTCAGCA, at roughly equal efficiency. The middle parts of these Maf-binding sequences completely match with two binding sequences for AP-1 transcription factor, i.e., phorbol 12-O-tetradecanoate-13-acetate (TPA)-responsive element (TRE) and cyclic AMP responsive element, suggesting partial overlapping of the target genes for Maf and AP-1. Furthermore, Maf efficiently formed heterodimers with the components of AP-1, Fos and Jun, through their leucine zipper structures, and these heterodimers show binding specificities distinct from those for Maf-Maf and Jun-Jun homodimers. Thus, a multiple combination of the dimers should generate a greatly expanded repertoire of transcriptional regulatory potential. DNA data base search for the Maf-binding consensus sequences suggested that some of the TRE-like cis elements reported previously may actually be the targets for Maf family proteins or their heterodimers with other bZip proteins.

Mouse MafA, homologue of zebrafish somite Maf 1, contributes to the specific transcriptional activity through the insulin promoter

“…On the other hand, nucleotide )130 "A" in RIPI obviously differs from nucleotide "G" in the other insulin promoters and in the MARE sequence. As we have demonstrated in this paper and as others have reported previously [22,24], "G" is crucial for Maf activity. This difference in the RIPI must be the reason why the Mafs did not activate the RIPI reporter in our experiments.…”

“…These results indicate that the responsible elements for Maf activation are located between )126 and )101 of RIPII. Since this region includes the RIPE3b element, which contains the Maf recognition element (MARE) like sequence [22] (Fig. 6E), we focused on the core site ()119 to )113) of the RIPE3b element as the Maf binding sequence.…”

“…It has been reported that large Mafs bind to the target DNA sequence by their basic domain and form either homodimers or heterodimers with other Mafs, Jun, or Fos [6,22,23] through their leucine-zipper domains. Maf dimers bind to TRE (TPA-responsive element)-type Maf recognition elements, T-MARE (TGCTGACTCAG CA), or CRE (cAMP-responsive element)-type MARE, C-MARE (TGCTGACGTCAGCA) [22,24].…”

“…Maf dimers bind to TRE (TPA-responsive element)-type Maf recognition elements, T-MARE (TGCTGACTCAG CA), or CRE (cAMP-responsive element)-type MARE, C-MARE (TGCTGACGTCAGCA) [22,24]. The chicken L-Maf was shown to recognize the core site (TGCTGAC, )108 to )102) within the aCE2 sequence (CTCCGCATTTCTGCTGACCAC, )119 to )99), which was defined as the lens-specific enhancer element in the chicken aA-crystallin promoter [25].…”

Recapitulation of human βB1‐crystallin promoter activity in transgenic zebrafish

“…To date, numerous members, including Maf-B, c-Maf, LMaf, S-Maf, and NRL, have been isolated, and they exhibit specific tissue expression patterns (reviewed in Blank and Andrews, 1997;Kajihara et al, 2001;Reza and Yasuda, 2004). These Maf proteins can form homodimers or heterodimers of the same family and also heterodimerize with c-Fos or c-Jun to exert their functions through palindromic recognition elements known as T-MARE (Kataoka et al, 1994;Kerppola and Curran, 1994;Matsushima and Sakai, 1998). Contrarily, our study, however, showed that the proximal minimal Ϫ90/ ϩ61-bp promoter, which contains a single conserved Maf binding site, is sufficient to transactivate the human ␤B1-crystallin gene.…”