Macrophage migration inhibitory factor gene polymorphism is not associated with pemphigus vulgaris in Iranian patients

Saeedi, Marjan Ghazi; Amoli, Mahsa M.; Robati, Reza M.; Sayahpour, Forough Azam; Namazi, Nastaran; Toossi, Parviz

doi:10.1111/j.1468-3083.2012.04676.x

Cited by 9 publications

(5 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The MIF gene polymorphism was genotyped using the polymerase chain reaction (PCR)-restriction fragment length polymorphism method as described previously [Saeedi et al, 2013].…”

Section: Polymorphism Genotypingmentioning

confidence: 99%

“…Although T cells are known as the main source of MIF production, other cell types including macrophages are also involved in MIF production and secretion. MIF is also considered as a proinflammatory cytokine with a range of targets which modulate the expression of a number of inflammatory molecules, including TNF-α, IL-6, IL-1b, IL-2, IL-8, and IFN-γ [Wang et al, 2012;Zhang et al, 2013] and playing an important immune regulatory role in several inflammatory diseases such as rheumatoid arthritis and atherosclerosis [Xiao et al, 2011;Saeedi et al, 2013].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Association between Macrophage Migration Inhibitory Factor Gene Variation and Response to Glucocorticoid Treatment in Sudden Sensorineural Hearing Loss

Yazdani¹,

Hamidi

Ghazavi³

et al. 2015

Audiol Neurotol

View full text Add to dashboard Cite

Several lines of evidence suggest the role of the immune system in the pathogenesis of sudden sensorineural hearing loss (SSNHL). Macrophage migration inhibitory factor (MIF) mediates its role in various immune and inflammatory conditions by the regulation of immune reactions. Several studies have confirmed an association between MIF gene polymorphisms and susceptibility to various inflammatory and autoimmune disorders. The aim of this study was to explore the association between the MIF (-173 G/C) polymorphism (rs755622) and SSNHL in an Iranian population. In this case-control association study, SSNHL cases (n = 77) were included. Normal healthy subjects (n = 100) were also recruited from the same region. Genotyping for MIF (-173 G/C) polymorphism was carried out using the polymerase chain reaction-restriction fragment length polymorphism technique. The frequency of the MIF -173 C allele carriers (GC + CC genotype) was significantly elevated in SSNHL patients who responded to glucocorticoid treatment compared with the patients with no response to treatment. These results suggest that the MIF gene polymorphism is associated with a response to glucocorticoid treatment in patients with SSNHL.

show abstract

“…The MIF gene polymorphism was genotyped using the polymerase chain reaction (PCR)-restriction fragment length polymorphism method as described previously [Saeedi et al, 2013].…”

Section: Polymorphism Genotypingmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Association between Macrophage Migration Inhibitory Factor Gene Variation and Response to Glucocorticoid Treatment in Sudden Sensorineural Hearing Loss

Yazdani¹,

Hamidi

Ghazavi³

et al. 2015

Audiol Neurotol

View full text Add to dashboard Cite

show abstract

“…Quality and quantity of the extracted DNA was observed by Nanodrop (UV–vis spectrophotometer; Thermo Scientific). Genotyping was performed using polymerase chain reaction (PCR) amplification and restriction fragment length polymorphism (RFLP) analysis by taking advantage of the following primers (Saeedi et al, , ): forward primer (5′‐ GAAGTCGAGGAAGAGAGAGACG–3′) and reverse primer (5′‐ CGGCGGTCACCCCCAAAA–3′). The assay was designed in the genetic laboratory of Endocrinology and Metabolism Research Institute.…”

Section: Methodsmentioning

confidence: 99%

“…Quality and quantity of the extracted DNA was observed by Nanodrop (UV-vis spectrophotometer; Thermo Scientific). Genotyping was performed using polymerase chain reaction (PCR) amplification and restriction fragment length polymorphism (RFLP) analysis by taking advantage of the following primers (Saeedi et al, 2013(Saeedi et al, , 2014:…”

Section: Dna Extraction and Genotypingmentioning

confidence: 99%

Is the +405 G/C single nucleotide polymorphism of the vascular endothelial growth factor (VEGF) gene associated with late‐onset vitiligo?

Almasi‐Nasrabadi

Amoli

Robati

et al. 2019

Int J Immunogenetics

View full text Add to dashboard Cite

The increasing body of evidence for the relationship between the vascular endothelial growth factor (VEGF) polymorphism and autoimmune disorders combined with the enhanced expression of this angiogenic factor in vitiligo makes VEGF a very interesting candidate gene to be investigated in vitiligo. The aim of this study was to evaluate the possible associations between the +405 G/C single nucleotide polymorphisms (SNP) of the VEGF gene (rs2010963) and vitiligo. The independent case–control population sample of 152 patients with vitiligo and 152 matched controls was evaluated in this study. A questionnaire was completed for each vitiligo patient to document the demographic and clinical characteristics of the patients. All enrolled individuals had a venous blood sample collected. Genotype frequencies for +405 G/C VEGF gene polymorphism were determined using polymerase chain reaction (PCR) amplification and restriction fragment length polymorphism (RFLP) analysis. There were no significant differences in genotype or allele distributions for this SNP between cases and controls. However, we observed a significant association between GG genotype and higher age at onset of vitiligo (p = 0.04). Moreover, patients stratification revealed a significant increase in the frequency of GG genotype compared to CC + CG genotypes in patients with the late onset (≥20 years) vitiligo (p = 0.05). Although these results are not conclusive, they could potentially lead to considering the angiogenic factors as a potential target for therapy in late‐onset vitiligo.

show abstract

“…Genetic variants of some other cytokine and cytokine receptor genes were analyzed in PV and/or PF: IL1A,IL1B,IL1R1,IL1RA,IL2,IL10,IL12,IL17RA,TNF,IFNG (interferon gamma), LTA (lymphotoxin alpha), MIF (macrophage migration inhibitory factor) and TGFB1 (transforming growth factor beta 1). No convincing associations were seen (Roxo et al, 2003;Pereira et al, 2004;Javor et al, 2010;Saeedi et al, 2013;Ben Jmaa et al, 2018). However, for each of these genes, just one or a few selected SNPs were analyzed.…”

Section: Lack Of Association With Some Remarkable Candidatesmentioning

confidence: 99%

Beyond the HLA polymorphism: A complex pattern of genetic susceptibility to pemphigus

Petzl-Erler

2020

Genet. Mol. Biol.

View full text Add to dashboard Cite

Pemphigus is a group of autoimmune bullous skin diseases that result in significant morbidity. As for other multifactorial autoimmune disorders, environmental factors may trigger the disease in genetically susceptible individuals. The goals of this review are to summarize the state of knowledge about the genetic variation that may affect the susceptibility and pathogenesis of pemphigus vulgaris and pemphigus foliaceus-both the endemic and the sporadic forms-, to compare and discuss the possible meaning of the associations reported, and to propose recommendations for new research initiatives. Understanding how genetic variants translate into pathogenic mechanisms and phenotypes remains a mystery for most of the polymorphisms that contribute to disease susceptibility. However, genetic studies provide a strong foundation for further developments in this field by generating testable hypotheses. Currently, results still have limited influence on disease prevention and prognosis, drug development, and clinical practice, although the perspectives for future applications for the benefit of patients are encouraging. Recommendations for the continued advancement of our understanding as to the impact of genetic variation on pemphigus include these partially overlapping goals: (1) Querying the functional effect of genetic variants on the regulation of gene expression through their impact on the nucleotide sequence of cis regulatory DNA elements such as promoters and enhancers, the splicing of RNA, the structure of regulatory RNAs and proteins, binding of these regulatory molecules to regulatory DNA elements, and alteration of epigenetic marks; (2) identifying key cell types and cell states that are implicated in pemphigus pathogenesis and explore their functional genomes; (3) integrating structural and functional genomics data; (4) performing disease-progression longitudinal studies to disclose the causal relationships between genetic and epigenetic variation and intermediate disease phenotypes; (5) understanding the influence of genetic and epigenetic variation in the response to treatment and the severity of the disease; (6) exploring gene-gene and genotype-environment interactions; (7) developing improved pemphigus-prone and non-prone animal models that are appropriate for research about the mechanisms that link genotypes to pemphigus. Achieving these goals will demand larger samples of patients and controls and multisite collaborations.

show abstract

Macrophage migration inhibitory factor gene polymorphism is not associated with pemphigus vulgaris in Iranian patients

Cited by 9 publications

References 39 publications

Association between Macrophage Migration Inhibitory Factor Gene Variation and Response to Glucocorticoid Treatment in Sudden Sensorineural Hearing Loss

Association between Macrophage Migration Inhibitory Factor Gene Variation and Response to Glucocorticoid Treatment in Sudden Sensorineural Hearing Loss

Is the +405 G/C single nucleotide polymorphism of the vascular endothelial growth factor (VEGF) gene associated with late‐onset vitiligo?

Beyond the HLA polymorphism: A complex pattern of genetic susceptibility to pemphigus

Contact Info

Product

Resources

About