Macrococcus canis sp. nov., a skin bacterium associated with infections in dogs

Abstract

Gram-stain-positive cocci were isolated from miscellaneous sites of the skin of healthy dogs as well as from infection sites in dogs. The closest relative by sequencing of the 16S rRNA gene was Macrococcus caseolyticus with 99.7 % sequence identity, but compared with M. caseolyticus, the novel strains shared only 90.8 to 93.5 % DNA sequence identity with cpn60, dnaJ, rpoB and sodA partial genes, respectively. The novel strains also exhibited differential phenotypic characteristics from M. caseolyticus, and the majority displayed a visible haemolysis on sheep blood agar, while M. caseolyticus did not have any haemolytic activity. They generated different matrix-assisted laser-desorption/ionization time-of-flight (MALDI-TOF) MS spectral profiles compared with the other species of the genus Macrococcus. Furthermore, strain KM 45013 shared only 53.7 % DNA-DNA relatedness with the type strain of M. caseolyticus, confirming that they do not belong to the same species. The DNA G+C content of strain KM 45013 was 36.9 mol%. The most abundant fatty acids were C14 : 0, C18 : 3ω6c (6, 9, 12) and C16 : 0 n alcohol. MK-6 was the menaquinone type of KM 45013. Cell-wall structure analysis revealed that the peptidoglycan type was A3α l-Lys-Gly2-l-Ser. Based on genotypic and chemotaxonomic characteristics, we propose to classify these strains within a novel species of the genus Macrococcus for which the name Macrococcus canis sp. nov. is proposed. The type strain is KM 45013 (=DSM 101690=CCOS 969=CCUG 68920).

Novel methicillin resistance gene mecD in clinical Macrococcus caseolyticus strains from bovine and canine sources

“…There are currently eight species included in the genus Macrococcus , namely M. caseolyticus, M. equipercicus, M. bovicus, M. carouselicus, M. brunensis, M. hajekii, M. lamae and M. canis 234. Macrococcus is mainly found commensally on the surface of the body of animals and has also been isolated from raw milk and dairy products567.…”

Macrococcus canis and M. caseolyticus in dogs: occurrence, genetic diversity and antibiotic resistance

“…Samples were taken using swabs (Transwab ® , MWE; Wiltshire, UK) from the skin and oral mucosa of the West Highland white terriers and the skin and ear canals of the Newfoundland dogs. Swabs were streaked on TSA‐SB plates (BBL™ Trypticase™ Soy Agar with 5% Sheep Blood, Becton, Dickinson and Company; Franklin Lakes, NJ, USA) and incubated at 37°C for 24 h. All of the colonies were subjected to matrix‐assisted laser desorption ionization‐time of flight mass spectrometry (MALDI‐TOF MS) identification (Microflex LT, Bruker Daltonics GmbH; Bremen, Germany) to detect Macrococcus species using the main spectra (MSP) of all known species contained in the authors MALDI‐TOF database . Seven Macrococcus strains previously isolated from infection sites of dogs were also included in the study (Table ).…”

“…Seven Macrococcus strains previously isolated from infection sites of dogs were also included in the study (Table ). Strain identification was confirmed by 16S rRNA gene sequencing . The nuc region of M. canis and M. caseolyticus was amplified by multiplex PCR as an additional method to genetically differentiate M. canis and M. caseolyticus using one consensus reverse primer (NUC_Macro_R, 5′‐ GCTGAGATGTCATTGGGCCT) and two forward primers, one specific for M. caseolyticus (NUC_Mcaseo_F, 5′‐ GTTTCTCACATTAAACTTTTCACCCT) and the other for M. canis (NUC_Mcanis_F, 5′‐ CGTGTCGGATATGTCTACCAAC), generating a 345 bp fragment for M. canis and a 688 bp fragment for M. caseolyticus .…”

“…It was originally placed into the Micrococcus genus, then the Staphylococcus genus and in 1998 it was assigned to its own Macrococcus genus . The genus Macrococcus currently contains eight species ( M. caseolyticus, M. carouselicus, M. equipercicus, M. bovicus, M. brunensis, M. hajekii and M. lamae ) including M. canis found in dogs . All Macrococcus belong primarily to the microbiota of mammals and M. caseolyticus was also found in milk and meat .…”

“…All Macrococcus belong primarily to the microbiota of mammals and M. caseolyticus was also found in milk and meat . An association of Macrococcus with infections has rarely been reported: so far there is only one history of abscesses in lambs with M. caseolyticus , and a few cases of rhinitis, dermatitis, mastitis and otitis in dogs with the novel M. canis species . Little is known about this novel bacterium and other Macrococcus in general, prompting us to investigate further the occurrence, genetic relationship and antibiotic resistance profile of Macrococcus species in West Highland white terriers and Newfoundland dogs.…”