Low β2-adrenergic receptor level may promote development of castration resistant prostate cancer and altered steroid metabolism

Abstract

The underlying mechanisms responsible for the development of castration-resistant prostate cancer (CRPC) in patients who have undergone androgen deprivation therapy are not fully understood. This is the first study to address whether β2-adrenergic receptor (ADRB2)- mediated signaling may affect CRPC progression in vivo. By immunohistochemical analyses, we observed that low levels of ADRB2 is associated with a more rapid development of CRPC in a Norwegian patient cohort. To elucidate mechanisms by which ADRB2 may affect CRPC development, we stably transfected LNCaP cells with shRNAs to mimic low and high expression of ADRB2. Two UDP-glucuronosyltransferases, UGT2B15 and UGT2B17, involved in phase II metabolism of androgens, were strongly downregulated in two LNCaP shADRB2 cell lines. The low-ADRB2 LNCaP cell lines displayed lowered glucuronidation activities towards androgens than high-ADRB2 cells. Furthermore, increased levels of testosterone and enhanced androgen responsiveness were observed in LNCaP cells expressing low level of ADRB2. Interestingly, these cells grew faster than high-ADRB2 LNCaP cells, and sustained their low glucuronidation activity in castrated NOD/SCID mice. ADRB2 immunohistochemical staining intensity correlated with UGT2B15 staining intensity in independent TMA studies and with UGT2B17 in one TMA study. Similar to ADRB2, we show that low levels of UGT2B15 are associated with a more rapid CRPC progression. We propose a novel mechanism by which ADRB2 may affect the development of CRPC through downregulation of UGT2B15 and UGT2B17.

PBX3 is a putative biomarker of aggressive prostate cancer

“…The RP2 cohort from Skåne University Hospital consists of 122 patients with localized prostate cancer operated in Malmö between 1998 and 2003, as described previously . In the androgen deprivation therapy (ADT) cohort, 61 patients treated with TUR‐P and ADT at Oslo University Hospital in the period 1992–2008 were identified retrospectively from medical records as described previously . The 20 patients included in the prostate cancer specific mortality (PCSM) stratified cohort were identified retrospectively from medical records based on the criteria that they either had died from prostate cancer (nine patients) or were alive 10 years post diagnosis (11 patients).…”

The β2-Adrenergic Receptor Is a Molecular Switch for Neuroendocrine Transdifferentiation of Prostate Cancer Cells

“…The tissue microarray (TMA) includes radical prostatectomy tissue from 122 patients treated at Ska ne University Hospital between 1999 and 2002 (20). The TMA was IHC stained as described previously (21) with an anti-ADRB2 primary antibody (MC2656; MBL Int.) in a 1:4,000 dilution.…”

“…In experiments involving androgen depletion, RPMI1640 was replaced with phenol red-free RPMI1640 (#32404014; Thermo Fisher Scientific), and FCS was replaced with 2% charcoal-stripped serum (CSS; #A3382101; Thermo Fisher Scientific). Stable knockdown of ADRB2 in LNCaP cells was performed as described previously (21). In the current study, we used an additional stable ADRB2 knockdown cell line (LNCaP shADRB2-3; insert sequence gaagtttacatcctcctaat).…”

Implication of β2-adrenergic receptor and miR-196a correlation in neurite outgrowth of LNCaP prostate cancer cells

“…In particular, three stable cell lines derived from LNCaP cells previously established by our group were used: LNCaP shADRB2-1, LNCaP shADRB2-2 and LNCaP shADRB2-3. These cells lines show respectively 50%, 85% and 80% reduced ADRB2 ligand binding activity compared to control (Ctrl) LNCaP cells (LNCaP shCtrl) [ 8 , 14 ]. We also showed by PCR the reduction of the mRNA levels of ADRB2 in LNCaP shADRB2-1, LNCaP shADRB2-2 and LNCaP shADRB2-3 compared to LNCaP shCtrl ( Fig 1A ).…”

“…The development of CRPC involves different mechanisms that are not fully understood [7]. A mechanism that has been investigated is signaling through the β2-adrenergic receptor (ADRB2) [8]. ADRB2 is a member of the G-protein-coupled receptor superfamily and, interestingly, both the ADRB2 mRNA and protein levels are generally increased in PCa cells compared to benign prostate cells [9][10][11].…”