Loss of stra8 Increases Germ Cell Apoptosis but Is Still Compatible With Sperm Production in Atlantic Salmon (Salmo salar)

Abstract

Entering meiosis strictly depends on stimulated by retinoic acid 8 (Stra8) gene function in mammals. This gene is missing in a number of fish species, including medaka and zebrafish, but is present in the majority of fishes, including Atlantic salmon. Here, we have examined the effects of removing stra8 on male fertility in Atlantic salmon. As in mammals, stra8 expression was restricted to germ cells in the testis, transcript levels increased during the start of puberty, and decreased when blocking the production of retinoic acid. We targeted the salmon stra8 gene with two gRNAs one of these were highly effective and produced numerous mutations in stra8, which led to a loss of wild-type (WT) stra8 expression in F0 salmon testis. In maturing stra8 crispants, the spermatogenetic tubuli were partially disorganized and displayed a sevenfold increase in germ cell apoptosis, in particular among type B spermatogonia and spermatocytes. The production of spermatogenic cysts, on the other hand, increased in maturing stra8 crispants. Gene expression analysis revealed unchanged (lin28a, ret) or reduced levels (egr1, dusp4) of transcripts associated with undifferentiated spermatogonia. Decreased expression was recorded for some genes expressed in differentiating spermatogonia including dmrt1 and ccnd2 or in spermatocytes, such as ccna1. Different from Stra8-deficient mammals, a large number of germ cells completed spermatogenesis, sperm was produced and fertilization rates were similar in WT and crispant males. While loss of stra8 increased germ cell apoptosis during salmon spermatogenesis, crispants compensated this cell loss by an elevated production of spermatogenic cysts, and were able to produce functional sperm. It appears that also in a fish species with a stra8 gene in the genome, the critical relevance this gene has attained for mammalian spermatogenesis is not yet given, although detrimental effects of the loss of stra8 were clearly visible during maturation.

The Piwil1 N domain is required for germ cell survival in Atlantic salmon

“…High scoring guide RNA (gRNA) target sequences were predicted using CRISPRscan (Moreno-Mateos et al, 2015). Templates for producing gRNAs were then made according to protocols published by Gagnon and co-workers ( Gagnon et al, 2014 ) with minor modifications as outlined in our previous publication ( Skaftnesmo et al, 2021 ). The guide used to target piwil1 ; AGG​CGC​CGA​GAC​TCC​ATG​ACG​GG, locates to chromosome 24, NC_027323.1.…”

“…The final denatured sequencing library was prepared at a concentration of 8 p.m. and spiked with 5% denatured phiX and sequenced on the MiSeq using MiSeq Reagent Kit v3 (600 cycle format). Analyses of the FASTQ sequences were performed using CRISPResso2 ( Clement et al, 2019 ) as previously described in Skaftnesmo et al (2021) . For the individuals that were Sanger sequenced (both F1 and piwil1 crispant fish), PCR amplicons were generated using forward primer; CAG​AGG​AAT​AGT​GCC​CTC​CA, and reverse primer; CCT​TTG​ATA​TTT​CCT​CAG​GT in a PCR reaction containing Q5 polymerase (NEB) according to the manufacturer’s recommendations.…”

“…All qPCR assays were previously published ( vasa, gsdf, cyp19a1a, amh ; Skaftnesmo et al, 2021 ). A qPCR reaction was prepared to contain 800 nM of each forward and reverse primer, 250 nM of the probe in a 6 µl reaction containing 1x concentration of the TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and 2 µl of a 1/20 diluted cDNA.…”

“…Interestingly, we found that the longest in-frame mutations in the N domain also led to loss of function, suggesting that losing 4-6 amino acids in this region of the N domain is incompatible with Piwil1 functionality. publication (Skaftnesmo et al, 2021). The guide used to target piwil1; AGGCGCCGAGACTCCATGACGGG, locates to chromosome 24, NC_027323.1.…”