Loss of p130 Accelerates Tumor Development in a Mouse Model for Human Small-Cell Lung Carcinoma

Abstract

Small-cell lung carcinoma (SCLC) is a neuroendocrine subtype of lung cancer. Although SCLC patients often initially respond to therapy, tumors nearly always recur, resulting in a 5-year survival rate of less than 10%. A mouse model has been developed based on the fact that the RB and p53 tumor suppressor genes are mutated in more than 90% of human SCLCs. Emerging evidence in patients and mouse models suggests that p130, a gene related to RB, may act as a tumor suppressor in SCLC cells. To test this idea, we used conditional mutant mice to delete p130 in combination with Rb and p53 in adult lung epithelial cells. We found that loss of p130 resulted in increased proliferation and significant acceleration of SCLC development in this triple-knockout mouse model. The histopathologic features of the triple-mutant mouse tumors closely resembled that of human SCLC. Genome-wide expression profiling experiments further showed that Rb/p53/p130-mutant mouse tumors were similar to human SCLC. These findings indicate that p130 plays a key tumor suppressor role in SCLC. Rb/p53/p130-mutant mice provide a novel preclinical mouse model to identify novel therapeutic targets against SCLC. Cancer Res; 70(10); 3877-83. ©2010 AACR.

Functional characterization of pulmonary neuroendocrine cells in lung development, injury, and tumorigenesis

“…4K). These observations confirm and extend previous reports (12)(13)(14)(15) suggesting that PNECs can be the cells of origin for SCLC, offering insight into the complex interactions between tumor suppressors in tumor development.…”

“…Perhaps the most important clinical connection comes from the observation that characteristic markers of PNECs are frequently expressed in human small-cell lung cancer (SCLC), a highly aggressive form of lung cancer related to cigarette smoking (11). This finding led to the speculation that PNECs could be the cells of origin for SCLC, an idea that has been supported by mouse studies (12)(13)(14)(15). Despite this insight, the ability to reliably trace the early events that underlie changes in PNEC behavior and their progression toward tumor development in a defined genetic setting has not been achieved.…”

Characterization of the cell of origin for small cell lung cancer

“…Deletion of Rb and p53 in the lung epithelium of Rb lox/lox ; p53 loxlox mice results in the development of lung tumors 9-12 mo after intranasal instillation of adenoviral particle expressing the Cre recombinase (Ad-Cre); the additional loss of the Rb-related gene p130 enhances tumor initiation and progression. 18 Rb/p53 and Rb/p53/p130 mutant tumors are often localized in the main airways (Fig. 1A and B and data not shown), where neuroendocrine cells are also present (Fig.…”

The Evolutionarily Conserved C-terminal Domains in the Mammalian Retinoblastoma Tumor Suppressor Family Serve as Dual Regulators of Protein Stability and Transcriptional Potency

“…An intergenic region on mouse chromosome 6 was used as a negative control. Primer sequences were as follows: CCNA2-F, AATAGTCGC-GGGCTACTTGA; CCNA2-R, GAGCGTAGAGCCCAG- (10) and SYBR Green Master Mix reagents with an ABI Step one plus thermocycler (Applied Biosystems) detection system. Primers sequences were as follows: RB-F, GCTTGGCTAACTTGGGAG; RB-R, CAAC-TGCTGCGATAAAGATG; p107-F, CCGAAGCCCTGGAT-GACTT; p107-R, GCATGCCAGCCAGTGTATAACTT; p130-F, AAGGCACATGCTAACCAATGAA; p130-R, GAGC-AGTTACCGCAGCATGA.…”

“…Ϫ/Ϫ null background enhanced development of small cell lung carcinoma (10). Thus, all three RB family members can act as tumor suppressors in specific contexts.…”