Loss-of-Function Mutations in the Human Ortholog of Chlamydomonas reinhardtii ODA7 Disrupt Dynein Arm Assembly and Cause Primary Ciliary Dyskinesia

Duquesnoy, Philippe; Escudier, Estelle; Vincensini, Laetitia; Freshour, Judy; Bridoux, Anne-Marie; Coste, A.; Deschildre, A.; Blic, J. de; Legendre, M.; Montantin, Guy; Tenreiro, Henrique; Vojtek, Anne-Marie; Loussert, Céline; Clément, Annick; Escalier, Denise; Bastin, Philippe; Mitchell, David R.; Amselem, Serge

doi:10.1016/j.ajhg.2009.11.008

Cited by 146 publications

(139 citation statements)

References 35 publications

Supporting

Mentioning

122

Contrasting

Unclassified

Order By: Relevance

“…S2). A similar result was obtained when using a polyclonal antibody against the intermediate dynein chain (DNAI1) of the outer dynein arm (Duquesnoy et al, 2009): the flagellum signal was unchanged in the old flagella after 2 days of RNAi induction (data not shown). We next turned our attention to the PFR, a large axonemal structure found alongside the axoneme (Portman and Gull, 2010).…”

Section: Ift Is Not Necessary For the Maintenance Of Flagellum Lengthsupporting

confidence: 64%

Intraflagellar transport is required for the maintenance of the trypanosome flagellum composition but not its length

Fort

Bonnefoy

Kohl

et al. 2016

Journal of Cell Science

Self Cite

View full text Add to dashboard Cite

Intraflagellar transport (IFT) is required for construction of most cilia and flagella. Here, we used electron microscopy, immunofluorescence and live video microscopy to show that IFT is absent or arrested in the mature flagellum of Trypanosoma brucei upon RNA interference (RNAi)-mediated knockdown of IFT88 and IFT140, respectively. Flagella assembled prior to RNAi did not shorten, showing that IFT is not essential for the maintenance of flagella length. Although the ultrastructure of the axoneme was not visibly affected, flagellar beating was strongly reduced and the distribution of several flagellar components was drastically modified. The R subunit of the protein kinase A was no longer concentrated in the flagellum but was largely found in the cell body whereas the kinesin 9B motor was accumulating at the distal tip of the flagellum. In contrast, the distal tip protein FLAM8 was dispersed along the flagellum. This reveals that IFT also functions in maintaining the distribution of some flagellar proteins after construction of the organelle is completed.

show abstract

Section: Ift Is Not Necessary For the Maintenance Of Flagellum Lengthsupporting

confidence: 64%

Intraflagellar transport is required for the maintenance of the trypanosome flagellum composition but not its length

Fort

Bonnefoy

Kohl

et al. 2016

Journal of Cell Science

Self Cite

View full text Add to dashboard Cite

show abstract

“…Primers were selected to hybridize outside the region selected for dsRNA expression to avoid amplification of RNA deriving from the dsRNA trigger. Primers CTTCAGAGGGCATCTAGAAAG (11,895 in the coding sequence) and CCTTGAAGATTCAGCAGGCGC (12,444) targeting a 570 bp sequence were used for FLAM3, and primers amplifying a 697 bp region of the ODA7 gene (Duquesnoy et al, 2009) were selected as control primers.…”

Section: Rt-pcrmentioning

confidence: 99%

Flagellar adhesion inTrypanosoma bruceirelies on interactions between different skeletal structures present in the flagellum and in the cell body

Rotureau

Blisnick

Subota

et al. 2013

Journal of Cell Science

Self Cite

View full text Add to dashboard Cite

The Trypanosoma brucei flagellum is an essential organelle anchored along the surface of the cell body through a specialized structure called the flagellum attachment zone (FAZ). Adhesion relies on the interaction of the extracellular portion of two transmembrane proteins, FLA1 and FLA1BP. Here, we identify FLAM3 as a novel large protein associated with the flagellum skeleton whose ablation inhibits flagellum attachment. FLAM3 does not contain transmembrane domains and its flagellar localization matches closely, but not exactly, that of the paraflagellar rod, an extraaxonemal structure present in the flagellum. Knockdown of FLA1 or FLAM3 triggers similar defects in motility and morphogenesis, characterized by the assembly of a drastically reduced FAZ filament. FLAM3 remains associated with the flagellum skeleton even in the absence of adhesion or a normal paraflagellar rod. However, the protein is dispersed in the cytoplasm when flagellum formation is inhibited. By contrast, FLA1 remains tightly associated with the FAZ filament even in the absence of a flagellum. In these conditions, the extracellular domain of FLA1 points to the cell surface. FLAM3 is essential for proper distribution of FLA1BP, which is restricted to the most proximal portion of the flagellum upon knockdown of FLAM3. We propose that FLAM3 is a key component of the FAZ connectors that link the axoneme to the adhesion zone, hence it acts in an equivalent manner to the FAZ filament complex, but on the side of the flagellum.

show abstract

“…PCD is a group of rare human genetic diseases characterized by recurrent infections of the respiratory system, male infertility, and frequently laterality defects, all of which are tightly linked to cilia motility abnormalities. Up to now, 19 PCD genes have been identified (2)(3)(4)(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20). However, combined they account for about 50% of all PCD cases, suggesting the existence of multiple additional causative genes.…”

mentioning

confidence: 99%

Reptin/Ruvbl2 is a Lrrc6/Seahorse interactor essential for cilia motility

Lei

Yuan

Cao

et al. 2013

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Primary ciliary dyskinesia (PCD) is an autosomal recessive disease caused by defective cilia motility. The identified PCD genes account for about half of PCD incidences and the underlying mechanisms remain poorly understood. We demonstrate that Reptin/ Ruvbl2, a protein known to be involved in epigenetic and transcriptional regulation, is essential for cilia motility in zebrafish. We further show that Reptin directly interacts with the PCD protein Lrrc6/Seahorse and this interaction is critical for the in vivo function of Lrrc6/Seahorse in zebrafish. Moreover, whereas the expression levels of multiple dynein arm components remain unchanged or become elevated, the density of axonemal dynein arms is reduced in reptin hi2394 mutants. Furthermore, Reptin is highly enriched in the cytosol and colocalizes with Lrrc6/Seahorse. Combined, these results suggest that the Reptin-Lrrc6/Seahorse complex is involved in dynein arm formation. We also show that although the DNA damage response is induced in reptin hi2394 mutants, it remains unchanged in cilia biogenesis mutants and lrrc6/seahorse mutants, suggesting that increased DNA damage response is not intrinsic to ciliary defects and that in vertebrate development, Reptin functions in multiple processes, both cilia specific and cilia independent.ciliopathy | chromatin remodeling complex | dynein arm assembly factor A lthough the sensory function of the cilium has garnered significant attention only in the past decade, defective cilia motility was recognized nearly four decades ago as the cause of primary (genetic) ciliary dyskinesia (PCD) (1). PCD is a group of rare human genetic diseases characterized by recurrent infections of the respiratory system, male infertility, and frequently laterality defects, all of which are tightly linked to cilia motility abnormalities. Up to now, 19 PCD genes have been identified (2-20). However, combined they account for about 50% of all PCD cases, suggesting the existence of multiple additional causative genes. Despite such significant advances, our understanding of how cilia motility is regulated is limited and the list of genes involved in cilia motility remains incomplete.In motile cilia or flagella, dynein arms are large protein complexes powering cilia motility. Not surprisingly, multiple PCD genes encode dynein arm components, including DNAL1, DNAI1, DNAI2, DNAH5, and DNAH11 (2-6). In addition, it is understood that dynein arm subunits are preassembled in the cytosol, transported into cilia/flagellum, and docked onto the axoneme, although the underlying mechanisms are poorly understood (21). In recent years, three PCD genes, i.e., DNAAF1/LRRC50 (7, 8), DNAAF2/ KTU (9), and DNAAF3/PF22 (10) have been shown to be involved in the assembly of dynein arm subunits, highlighting the relevance and importance of this process in cilia motility and PCD.Very recently, mutations in human LRRC6/SEAHORSE were linked to PCD (18). Similar to the three known dynein arm assembly factors, mutations in LRRC6/SEAHORSE lead to the absence of both the outer...

show abstract

Loss-of-Function Mutations in the Human Ortholog of Chlamydomonas reinhardtii ODA7 Disrupt Dynein Arm Assembly and Cause Primary Ciliary Dyskinesia

Cited by 146 publications

References 35 publications

Intraflagellar transport is required for the maintenance of the trypanosome flagellum composition but not its length

Intraflagellar transport is required for the maintenance of the trypanosome flagellum composition but not its length

Flagellar adhesion inTrypanosoma bruceirelies on interactions between different skeletal structures present in the flagellum and in the cell body

Reptin/Ruvbl2 is a Lrrc6/Seahorse interactor essential for cilia motility

Contact Info

Product

Resources

About