Loss of chaperone-mediated autophagy is associated with low vertebral cancellous bone mass

Abstract

Chaperone-mediated autophagy (CMA) is a protein degradation pathway that eliminates soluble cytoplasmic proteins that are damaged, incorrectly folded, or targeted for selective proteome remodeling. However, the role of CMA in skeletal homeostasis under physiological and pathophysiological conditions is unknown. To address the role of CMA for skeletal homeostasis, we deleted an essential component of the CMA process, namely Lamp2a, from the mouse genome. CRISPR-Cas9-based genome editing led to the deletion of both Lamp2a and Lamp2c, another Lamp2 isoform, producing Lamp2AC global knockout (L2ACgKO) mice. At 5 weeks of age female L2ACgKO mice had lower vertebral cancellous bone mass compared to wild-type (WT) controls, whereas there was no difference between genotypes in male mice at this age. The low bone mass of L2ACgKO mice was associated with elevated RANKL expression and the osteoclast marker genes Trap and Cathepsin K. At 18 weeks of age, both male and female L2ACgKO mice had lower vertebral cancellous bone mass compared to WT controls. The low bone mass of L2ACgKO mice was associated with increased osteoclastogenesis and decreased mineral deposition in cultured cells. Consistent with these findings, specific knockdown of Lamp2a in an osteoblastic cell line increased RANKL expression and decreased mineral deposition. Moreover, similar to what has been observed in other cell types, macroautophagy and proteasomal degradation were upregulated in CMA-deficient osteoblasts in culture. Thus, an increase in other protein degradation pathways may partially compensate for the loss of CMA in osteoblasts. Taken together, our results suggest that CMA plays a role in vertebral cancellous bone mass accrual in young adult mice and that this may be due to an inhibitory role of CMA on osteoclastogenesis or a positive role of CMA in osteoblast formation or function.

Loss of chaperone‐mediated autophagy does not alter age‐related bone loss in male mice

“…Osteoblastic UAMS‐32 cells were cultured in α‐MEM containing 10% fetal bovine serum and 1% penicillin/streptomycin/glutamine. Lamp2a knockdown was performed as previously described 15 . Briefly, UAMS‐32 cells were infected with lentivirus expressing Lamp2a shRNA (target sequence GAAGCACTTTGCTCCTTAAGA) or scrambled control (GeneCopoeia, vector psi‐LVRU6GP).…”

“…Production of L2ACgKO mice was previously described 15 . Briefly, Lamp2 exon 9A and Lamp2 exon 9C were deleted from the mouse genome with CRISPR/Cas9 genome editing.…”

“…The femurs and vertebrae were dissected, cleaned of soft tissue, wrapped in saline‐soaked gauze, and stored at −20°C. The microCT scans were performed on a model uCT40 (Scanco Biomedical) as previously described 15,19 . Briefly, medium‐resolution scans were obtained (12 μm isotropic voxel size).…”

Autophagy: An important target for natural products in the treatment of bone metabolic diseases

“…As with macro-autophagy, CMA similarly responds to nutrient deficiency (Cuervo et al, 1995), oxidative stress (Kaushik and Cuervo, 2006), hypoxia (Hubbi et al, 2013), genotoxic (Park et al, 2015) and other stimuli. Unlike macroautophagy, CMA does not utilize autophagosomes, chaperone HSC70 and cochaperones deliver protein cargoes containing specific KFERQ-like sequences directly to the lysosome, where they are then transported via lysosome-associated membrane protein type 2A (LAMP2A) translocation system is transferred into the lysosome (Sahu et al, 2011;Akel et al, 2022). Compared to the wild type, vertebral cancellous bone mass was significantly lower in LAMP2A and LAMP2C global knockout mice, which was associated with increased osteoclastogenesis due to increased RANKL expression (Akel et al, 2022).…”

“…Unlike macroautophagy, CMA does not utilize autophagosomes, chaperone HSC70 and cochaperones deliver protein cargoes containing specific KFERQ-like sequences directly to the lysosome, where they are then transported via lysosome-associated membrane protein type 2A (LAMP2A) translocation system is transferred into the lysosome (Sahu et al, 2011;Akel et al, 2022). Compared to the wild type, vertebral cancellous bone mass was significantly lower in LAMP2A and LAMP2C global knockout mice, which was associated with increased osteoclastogenesis due to increased RANKL expression (Akel et al, 2022). BMSCs also exhibited higher CMA activity during osteogenic differentiation, this trend promotes the transition of BMSCs to OBs while inhibiting the potential of BMSCs to differentiate into lipogenic cells and chondrocytes (Gong et al, 2021).…”