Long‐term optimization of crop yield while concurrently improving soil quality

Abstract

Sustainably feeding the growing human population requires improvements in both soil quality and nitrogen (N) management. However, in response to N fertilizer addition, whether soil quality will be optimized at N application rates that maximize yields is rarely explored from a long‐term perspective. We conducted a 9‐year field experiment to examine agronomic and soil quality indices in a wheat (Triticum aestivum L.)/maize (Zea mays L.) double cropping system. Optimal nitrogen rates (ONR) were determined by in‐season soil NO3−‐N testing. Other treatments included control plots, 50–70% ONR, 130–150% ONR, and local farmers' N practices (FNP). The ONR increased grain yield by 10.5% in comparison with the 50–70% ONR treatment and achieved yields comparable to the 130–150% ONR treatment. The ONR treatment reduced the applied N fertilization rate by 38.5% in comparison with FNP levels but without any yield losses. After N fertilization for 9 years, soil organic carbon (SOC) stocks, C sequestration rates, and soil microbial biomass C were the highest with the ONR treatment. Relative to the control, the ONR treatment significantly increased the weight diameter of soil water‐stable aggregates, reduced the richness and diversity of fungi, and reduced the richness of bacteria in comparison with the FNP treatment. Furthermore, the soil microbial community structure had a significant relationship with the SOC, organic C input, and soil inorganic N content, which was ascribed to the driving of N management strategy. These results highlight the importance of the optimization of N management to produce high grain with less N fertilizer input in agricultural systems while concurrently promoting soil quality and providing benefits to the microbial community.

Effect of Different Combinations of Phosphorus and Nitrogen Fertilization on Arbuscular Mycorrhizal Fungi and Aphids in Wheat

“…The response of wheat growth to soil nutrient levels has received much attention. Many studies have shown that N is a major limiting factor in crop production, with a positive relationship between wheat yield and N amount [63][64][65]. Our results are consistent with these studies, and we found that aboveground biomass and yield increased with increasing N. Such effects of N on wheat yield are reasonable, because increasing N levels significantly increase the grain count, the number of spikes, and the thousand-grain weight [66].…”

Soil organic carbon increment sources and crop yields under long‐term conservation tillage practices in wheat‐maize systems

“…Wiesmeier et al () introduced leguminous plants and hairy vetch into crop rotation systems, improved agricultural management and maintenance of windbreaks, promoted SOC sequestration, reduced extensive soil erosion and compaction, and ensured agricultural production in Moldova. Pan, Zhang, He, Chen, and Cui () reported that the optimization of nitrogen management improved the soil quality and the microbial community and provided an opportunity for the sustainable intensification of the agricultural system.…”

Improving soil quality for higher grain yields in Chinese wheat and maize production

“…The methods we used for DNA isolation, polymerase chain reaction (PCR) amplification, Miseq sequencing, and the processing of sequencing data are described in detail by Pan, Zhang, He, Chen, and Cui (). We extracted DNA in each soil sample using the QIAamp Fast DNA Stoll Mini Kit (Qiagen, Venlo, The Netherlands), following the manufacturer's protocol.…”

“…In PCR, the bacterial V3 + V4 region of the 16S rDNA gene and the fungal ITS1 region of the 18S rDNA gene were amplified using the primer pair 338F/806R (5′‐CTCCTACGGGAGGCAGCA‐3′/5′‐ GGACTACHVGGGTWTCTAAT‐3′; (Bates et al, 2011; Caporaso et al, 2012) and SSU0817F/ 1196R (5′‐TTAGCATGGAATAATRRAATAGGA‐3′/5′‐TCTGGACCTGGTGAGTTTCC‐3′; (Bokulich et al, ; Vasileiadis et al, ) together with the Illumina adaptor sequence and barcode sequences, respectively. The PCR reactions were also described by Pan et al (); the specific operation was as follows: 2 μl 2.5 mM of dNTPs, 4‐μl PCR reaction buffer, 10‐ng template DNA, 0.8 μl 5 μM of each primer, and 0.5‐U Trans Start Fast Pfu DNA polymerase (TransGen Biotech, Beijing, China) were contained in 20‐ml reaction volumes. The PCR conditions were as follows: 95°C for 3 min, followed by 27 cycles for 16S rDNA and 35 cycles for 18S rDNA.…”