Long‐term nitrogen input alters plant and soil bacterial, but not fungal beta diversity in a semiarid grassland

Abstract

Anthropogenic nitrogen (N) input is known to alter plant and microbial α‐diversity, but how N enrichment influences β‐diversity of plant and microbial communities remains poorly understood. Using a long‐term multilevel N addition experiment in a temperate steppe, we show that plant, soil bacterial and fungal communities exhibited different responses in their β‐diversity to N input. Plant β‐diversity decreased linearly as N addition increased, as a result of increased directional environmental filtering, where soil environmental properties largely explained variation in plant β‐diversity. Soil bacterial β‐diversity first increased then decreased with increasing N input, which was best explained by corresponding changes in soil environmental heterogeneity. Soil fungal β‐diversity, however, remained largely unchanged across the N gradient, with plant β‐diversity, soil environmental properties, and heterogeneity together explaining an insignificant fraction of variation in fungal β‐diversity, reflecting the importance of stochastic community assembly. Our study demonstrates the divergent effect of N enrichment on the assembly of plant, soil bacterial and fungal communities, emphasizing the need to examine closely associated fundamental components (i.e., plants and microorganisms) of ecosystems to gain a more complete understanding of ecological consequences of anthropogenic N enrichment.

Decoupled responses of above‐ and below‐ground stability of productivity to nitrogen addition at the local and larger spatial scale

“…Although beta diversity decreased with N addition but did not contribute to gamma stability in our ecosystem. Similarly, plant beta diversity decreased linearly with N addition in a temperate steppe due to increased directional environmental filtering (Liu et al, 2021). The lack of contribution of beta diversity to spatial asynchrony contrasts with theoretical and experimental evidence (Liang et al, 2021; Wang & Loreau, 2014, 2016; Wang et al, 2021).…”

Partitioning of beta‐diversity reveals distinct assembly mechanisms of plant and soil microbial communities in response to nitrogen enrichment

“…Soil elements and pH were measured using air‐dried subsamples. The details of measurement of soil‐extractable Al 3+ and Mn 2+ , soil N concentration, and soil pH value were described in a previous study by Liu et al, ( 2021 ).…”

“…The V3‐V4 region of bacterial 16S rRNA gene was amplified using the primer sets 338F (5′‐ACTCCTACGGGAGGCAGCAG‐3′) and 806R (5′‐GGACTACHVGGGTWTCTAAT‐3′). The ITS1 region of fungi was amplified using the primer sets ITS1‐F (5′‐CTTGGTCATTTAGAGGAAGTAA‐3′) and ITS2 (5′‐TGCGTTCTTCATCGATGC‐3′) (Liu et al, 2021 ). Amplicons were sequenced on the Illumina MiSeq PE300 platform.…”

“…Amplicons were sequenced on the Illumina MiSeq PE300 platform. The detailed amplicon analysis procedure has been described in a previous study by Liu et al, ( 2021 ). In brief, after removing low‐quality bases, we assembled the pair‐end reads using FLASH software (Magoč & Salzberg, 2011 ), and then removed barcodes, primers, and low‐quality reads from the assembled sequences using MOTHUR software (Schloss et al, 2009 ).…”

Short-Term Snow Removal Alters Fungal but Not Bacterial Beta Diversity and Structure during the Spring Snowmelt Period in a Meadow Steppe of China

“…Change in N could potentially influence the relative importance of deterministic and stochastic processes, and therefore, the trajectories of soil microbial community assembly. For example, a recent study showed that N input was correlated with soil bacterial diversity but not fungal beta diversity [ 22 ]. In addition, snow cover changes may have a greater impact on fungal community composition, which is closely related to nutrient cycling and plant growth [ 23 , 24 ].…”