Long-term correction of bilirubin UDPglucuronyltransferase deficiency in rats by in utero lentiviral gene transfer

Abstract

Bilirubin is glucuronidated by bilirubin UDP-glucuronyltransferase (UGT1A1) before biliary excretion. Because bilirubin is toxic, patients with Crigler-Najjar type I (CN), who have no UGT1A1 activity, suffer severe brain damage early in childhood. The Gunn rat is the model for CN type 1. Gunn rat fetuses were injected with 10(7) transducing units of UGT1A1 lentiviral vector at the end of the third trimester on embryonic day 19. Serum bilirubin of injected Gunn rats was lowered by 45% compared to untreated controls. This decrease was highly significant (P < 10(6)) and was sustained for more than a year. In treated Gunn rats, bilirubin glucuronides were present in bile and UGT1A1 protein was detected in tissue. Liver, intestine, stomach, pancreas, and other organs were transduced and mostly contained 1% or less vector copies per genome. Tissue distribution was variable among experimental animals but high transduction levels were seen in pancreas and intestine in most animals. Immunohistochemistry of these organs revealed transduction of pancreatic acinar cells and intestinal epithelium. Injection of a lentiviral UGT1A1 vector into third-trimester Gunn rat fetuses corrects the metabolic deficiency and mediates a reduction of serum bilirubin levels that would be therapeutic in humans.

Immune response to lentiviral bilirubin UDP-glucuronosyltransferase gene transfer in fetal and neonatal rats

“…[16][17][18] We have previously injected fetal Gunn rats with UGT1A1 lentiviral vectors and showed correction of hyperbilirubinemia. 19 When we injected similar doses of lentiviral vectors in neonatal Gunn rats, we observed a correction of hyperbilirubinemia that slowly decreased over time. This decrease in therapeutic effect was accompanied by the appearance of antibodies against human UGT1A1.…”

“…19 To generate PGKUGT1A1, the human UGT1A1 cDNA was cloned as a SpeI fragment into the XbaI site of the lentiviral transfer vector PGKGFP replacing the GFP gene of this vector. In these vectors, the phosphoglycerate kinase (PGK) promoter is driving expression of the transgene.…”

“…19 To reduce the risk of contamination, a forward primer in the U3 region (ctggaagggctaattcactc) and a reverse primer in the packaging region (ggtttccctttcgctttcag) were selected for amplification. This primer pair only amplifies the integrated provirus and not the transfer vector.…”

Gene Therapy Progress and Prospects: Fetal gene therapy – first proofs of concept – some adverse effects

“…The first widely accepted confirmation for the concept of fetal gene therapy has only recently been provided by the correction of several different disease phenotypes in relevant animal models. [3][4][5][6] Since gene therapy for genetic diseases requires lifelong correction, a vector system with the capability of permanent transgene expression such as retro/ lentiviruses appears presently as the best choice. However, the recent occurrence of oncogenesis by such vectors (see below) indicates their present limitations.…”

Fetal and neonatal gene therapy: benefits and pitfalls

“…These include glycogen storage disease type Ia, 1 mucopolysaccharidosis type VII, [2][3][4][5][6] bilirubin-UDP-glucuronosyltransferase deficiency (Crigler-Najjar syndrome), 7,8 haemophilias A 9 and B [10][11][12] and congenital blindness (Leber congenital amaurosis). 13 To fully understand the basis of these successful experiments in order to move towards clinical application, several key factors concerning early gene transfer must be closely examined.…”