Long noncoding RNA MINCR regulates cellular proliferation, migration, and invasion in hepatocellular carcinoma

Cao, Jinyu; Zhang, Deyuan; Zeng, Liangtao; Liu, Fanrong

doi:10.1016/j.biopha.2018.03.041

Cited by 17 publications

(18 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Recent studies have showed that lncRNA MINCR plays oncogenic roles in cancers, such as gallbladder cancer and hepatocellular carcinoma [14, 15]. However, its precise roles in NSCLC and the underlying mechanisms are not fully elucidated.…”

Section: Discussionmentioning

confidence: 99%

“…For over-expression studies, the full-length MINCR was synthesized by GeneScript Co. (Nanjing, China), and then cloned into the BamHI and EcoRI sites of pcDNA 3.1(+) expression vector. Transfection was carried out in accordance with the instructions of Lipofectamine 2000 transfection reagent (Invitrogen) [15–17]. The final concentration of MINCR siRNAs and their negative controls for transfection were 25 nM.…”

Section: Methodsmentioning

confidence: 99%

“…First strand cDNA synthesis kit and AceQ qPCR kit were all from Vazyme (Vazyme Biotech, Nanjing, China). The following primer pairs were used: MINCR (Forward: 5′- GTGTCTGGACACCAGAGGAGT − 3′; Reverse: 5′- GGGGCAGAGTCACAAAGC − 3′) and GAPDH: (Forward: 5′- CAAGGTCATCCATGACAACTTTG − 3′; Reverse: 5′- GTCCACCACCCTGTTGCTGTAG -3′) [13, 15, 19, 21].…”

Section: Methodsmentioning

confidence: 99%

“…About 3 years ago, Doose et al discovered that MYC-induced lncRNA (MINCR) was able to modulate the transcriptional network of MYC (c-Myc) in Burkitt lymphoma cells [13]. After that, MINCR was found to be significantly increased, and play an oncogenic role in cancers, such as gallbladder cancer and hepatocellular carcinoma [14, 15]. Wang et al revealed that MINCR promotes gallbladder cancer progression in part by sponging miR-26a-5p and activating enhancer of zeste homolog 2 (EZH2) signaling; while Cao et al reported that MINCR enhances the proliferation, migration, and invasion of hepatocellular carcinoma cells [14, 15].…”

Section: Introductionmentioning

confidence: 99%

“…After that, MINCR was found to be significantly increased, and play an oncogenic role in cancers, such as gallbladder cancer and hepatocellular carcinoma [14, 15]. Wang et al revealed that MINCR promotes gallbladder cancer progression in part by sponging miR-26a-5p and activating enhancer of zeste homolog 2 (EZH2) signaling; while Cao et al reported that MINCR enhances the proliferation, migration, and invasion of hepatocellular carcinoma cells [14, 15]. All these studies imply that MINCR could be a therapeutic target as well as prognostic marker for cancer treatment.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Roles of MYC-targeting long non-coding RNA MINCR in cell cycle regulation and apoptosis in non-small cell lung Cancer

Chen

et al. 2019

Respir Res

View full text Add to dashboard Cite

Background Non-small cell lung cancer (NSCLC) is one of the leading causes of cancer death in the world, and has a relatively low survival rate. Long non-coding RNAs (lncRNAs) have been demonstrated to modulate cancer progression through a variety of molecular mechanisms. We sought to investigate the role and potential mechanism of MYC-induced long non-coding RNA (MINCR) in NSCLC. Methods Expression levels of MINCR was first identified using The Cancer Genome Atlas (TCGA), further confirmed with specimens from 29 NSCLC patients and three cell lines using qRT-PCR. Overexpression and knockdown of MINCR were performed in NSCLC cell lines through MINCR overexpression vectors and synthesized siRNAs, respectively. The roles of MINCR in NSCLC cell lines, such as cell proliferation, cell cycle arrest, and apoptosis, were identified by MTT, flow cytometry, and Western blot. The modulation of MINCR-regulated genes, including c-Myc and its downstream effectors, as well as apoptosis-associated genes, was analyzed using Western blot. Results MINCR expression was increased in NSCLC patients from TCGA datasets, and was also significantly increased in our collected specimens from NSCLC patients and NSCLC cell lines. Knocking down of MINCR greatly inhibited the growth of NSCLC cell lines PC9 and A549. In addition, silencing of MINCR induced cell cycle arrest and apoptosis. Furthermore, silencing of MINCR reduced the expression levels of oncogene c-Myc and its downstream cyclin A, cyclin D, CD4, and CDK2, as well as apoptosis-associated Bcl-2, while significantly increased the expression levels of cleaved PARP-1. In the meantime, overexpression of MINCR remarkably enhanced cell proliferation of PC9 cells and activated c-Myc and its downstream effectors. Conclusion MINCR exerted inhibitory effects on the cell cycle arrest and apoptosis of NSCLC cells by activating c-Myc and its downstream effectors, suggesting that this lncRNA could be used as a potential therapeutic target for the treatment of NSCLC. Electronic supplementary material The online version of this article (10.1186/s12931-019-1174-z) contains supplementary material, which is available to authorized users.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Roles of MYC-targeting long non-coding RNA MINCR in cell cycle regulation and apoptosis in non-small cell lung Cancer

Chen

et al. 2019

Respir Res

View full text Add to dashboard Cite

show abstract

Retracted: IL‐6/STAT3 pathway intermediates M1/M2 macrophage polarization during the development of hepatocellular carcinoma

Yin

Lin

et al. 2018

J of Cellular Biochemistry

215

165

View full text Add to dashboard Cite

Human cancers, including hepatocellular carcinoma (HCC), are characterized by a high degree of drug resistance in chemotherapy. However, the underlying molecular mechanism remains unknown. To the role of interleukin-6 (IL-6)/signal transducer and activator of transcription 3 (STAT3) signaling pathway in the regulation of macrophage polarization, M1-type and M2-type macrophages were separately induced using lipopolysaccharide and interleukin-4 (IL-4), and we found that the IL-6/STAT3 signaling pathway was inhibited in M1-type macrophages but activated in M2-type macrophages. After anti-IL-6-treated macrophages were separately induced by lipopolysaccharide and IL-4, we found that the inhibition of IL-6/STAT3 signaling pathway turned macrophages into M1-type. Co-culture with M1-type macrophages reduced HCC cell viability, proliferation, invasion, migration, drug resistance, but increased apoptosis. Co-culture with M2-type macrophages yielded reciprocal results. The inhibition of IL-6/STAT3 signaling pathway mediated by anti-IL6 was shown to significantly enhance the effects of M1-type macrophages on HCC cells and rescue HCC cells from co-culture with M2-type macrophages. Tumor xenografts of co-cultured HCC cells were established in nude mice and the results showed that the inhibition of IL-6/STAT3 signaling pathway mediated by anti-IL6 was found to reduce tumor formation of HCC cells co-cultured with M1- or M2-type macrophages and lung metastases. The current study reveals a novel mechanism of IL-6/STAT3 signaling pathway in the regulation of macrophage polarization, thus contributing to HCC metastasis and drug resistance in chemotherapy.

show abstract

The miR‐28‐5p‐CAMTA2 axis regulates colon cancer progression via Wnt/β‐catenin signaling

Luan

Wang

Gai

2019

J of Cellular Biochemistry

View full text Add to dashboard Cite

Background Colon cancer is the third most commonly diagnosed cancer with high morbidity and mortality. Calmodulin‐binding transcription activator 2 (CAMTA2) belongs to the calmodulin‐binding transcription activator protein family. The functional role of CAMTA2 in colon cancer development remains unclear. Our research found out that CAMTA2 was high‐level expressed in colon cancer, and the upregulated CAMTA2 expression was markedly correlated with poor survival. Functional experiments showed that knockdown of CAMTA2 repressed colon cancer cell proliferation/migration in vitro and attenuated proliferation in vivo. In additional, CAMTA2 expression was controlled by miR‐28‐5p via posttranscriptional regulation and miR‐28‐5p expression was reversely correlated with CAMTA2 expression in colon cancer. Moreover, enforced miR‐28‐5p expression downregulated the expression of CAMTA2 significantly and the restoration of CAMTA2 expression abolished the inhibitory effect of miR‐28‐5p on colon cancer cell proliferation and metastasis. Mechanistically, overexpression of miR‐28‐5p suppressed Wnt/β‐catenin signaling and the inhibitory could be partly abolished by overexpression of CAMTA2. In summary, our findings reveal that miR‐28‐5p/CAMTA2 axis plays a critical role in human colon cancer, which might be a promising diagnosis and therapeutic target for colon cancer treatment.

show abstract

Long noncoding RNA MINCR regulates cellular proliferation, migration, and invasion in hepatocellular carcinoma

Cited by 17 publications

References 24 publications

Roles of MYC-targeting long non-coding RNA MINCR in cell cycle regulation and apoptosis in non-small cell lung Cancer

Roles of MYC-targeting long non-coding RNA MINCR in cell cycle regulation and apoptosis in non-small cell lung Cancer

Retracted: IL‐6/STAT3 pathway intermediates M1/M2 macrophage polarization during the development of hepatocellular carcinoma

The miR‐28‐5p‐CAMTA2 axis regulates colon cancer progression via Wnt/β‐catenin signaling

Contact Info

Product

Resources

About