Local Population Differentiation and Phylogenetic Relationships of Russian Brown Frog, <i>Rana amurensis</i> Inferred by Mitochondrial Cytochrome b Gene Sequences (Amphibia, Ranidae)

Abstract

In order to assess local population differentiation and phylogenetic relationships of a Russian brown frog, Rana amurensis, the sequences of 587 base pairs of the mitochondrial cytochrome b genes are compared with seven species of Japanese and one species complex of Taiwanese brown frogs (R. pirica, R. ornativentris, R. dybowskii, R. japonica, R. okinavana, R. tagoi, R. tsushimensis, and the R. sauteri complex). Genetic differentiation between populations of R. amurensis from Sakhalin and the Maritime Territory was found to be minimal. The resultant phylogenetic tree indicates monophyly of brown frogs and earliest divergence of R. amurensis among all the brown frogs studied. For this reason, separation of R. amurensis from the R. japonica group is suggested, but separation of the R. sauteri complex as a distinct genus or subgenus Pseudorana is not supported.

Phylogenetic Relationships of Brown Frogs with 24 Chromosomes from Far East Russia and Hokkaido Assessed by Mitochondrial CytochromebGene Sequences (Rana: Ranidae)

“…There should have been a land bridge between Sakhalin and the continent until the last glacial period (Ohshima, 1990). Further, R. amurensis, coinhabiting R. pirica on Sakhalin, has a wide range of distribution on the continent and its invasion into the Sakhalin Island is estimated to be a rather recent event (Tanaka-Ueno et al, 1998). From these considerations, it would be safe to suspect that a brown frog having a close phylogenetic affinity with R. pirica occurs in the continental regions adjacent to Sakhalin, such as Khabarovsk.…”

“…1; see Appendix). Unpublished sequence data (Tanaka-Ueno et al, unpublished) for R. chensinensis (topotypes) and published data for R. dybowskii from Tsushima, R. ornativentris (all 2n = 24), R. japonica, and R. amurensis from Sakhalin (all 2n = 26) (Tanaka-Ueno et al, 1998) were utilized for comparisons. Data for Xenopus laevis (Dunon-Bluteau et al, 1985) and R. catesbeiana (Tanaka et al, 1996) were also used as those for the outgroup.…”

Mitochondrial phylogeography of the moor frog, Rana arvalis

“…DNA was extracted by standard proteinase K‐phenol–chloroform protocol from frozen or alcohol‐preserved tissues. A 791 bp fragment of the mt cytochrome b gene was amplified with primers ralu1 (5′AACCTTATGACCCCAACAATACG3′) (Bos & Sites 2001) and modified H15502 ( 5′GGGTTAGCTGGTGTAAAATTGTCTGGG3′) (Tanaka‐Ueno et al . 1998).…”

“…DNA was extracted by standard proteinase K-phenolchloroform protocol from frozen or alcohol-preserved tissues. A 791 bp fragment of the mt cytochrome b gene was amplified with primers ralu1 (5′AACCTTATGACCCC-AACAATACG3′) (Bos & Sites 2001) and modified H15502 (5′GGGTTAGCTGGTGTAAAATTGTCTGGG3′) (Tanaka-Ueno et al 1998). Thirty µL polymerase chain reactions (PCR) contained 3 µL of 10 × PCR buffer with (NH 4 ) 2 SO 4 (Fermentas), 2.5 mm MgCl 2 , 1 mm of the forward and reverse primers, 0.2 mm of each dNTP and 0.5 U of Taq polymerase (Fermentas).…”

Sequence variation and structural conservation in the D-loop region and flanking genes of mitochondrial DNA from Japanese pond frogs.

“…Many recent studies have reported on amphibians using mtDNA sequences to reconstruct intraand interspecific phylogenies using the cyt b gene, ND1 gene, and D-loop region sequences (Moritz et al, 1992;Shaffer and McKnight, 1996;García-París et al, 1998;Tanaka et al, 1994Tanaka et al, , 1996Tanaka et al, , 1998Tanaka-Ueno et al, 1998a, b;Macey et al, 1998;Sumida et al , 2000Lee et al, 1999). Intergeneric, interfamily, and interorder phylogenies have been studied using the 12S and 16S rRNA gene sequences Hay et al, 1995;Titus and Larson, 1995;Ruvinsky and Maxson, 1996;Moore, 1996, 1998;Kobel et al, 1998).…”