Local expression of antiinflammatory cytokines in cancer.

Abstract

To characterize the nature of the local cytokine response to cancer, we chose to investigate cytokine patterns in biopsy specimens of basal cell carcinoma (BCC). We hypothesized that a distinct pattern of local cytokine production may be characteristic of BCC, a neoplasia of epidermis, in comparison to the pattern of seborrheic keratosis (SK), a benign growth of epidermis. We analyzed cytokine mRNAs in BCC versus SK by performing polymerase chain reaction on mRNA derived from biopsy specimens. The mRNAs encoding cytokines for IL4, IL-5, IL-10, and granulocyte macrophage colony-stimulating factor were strongly expressed in BCC lesions and weakly expressed in SK lesions. Conversely, IL-2, IFN-,y, and lymphotoxin mRNAs were strongly expressed in SK lesions and weakly expressed in BCC lesions. The response to malignancy, BCC, was typified by cytokines characteristic of murine TH2 cells. This cytokine pattern favors humoral immunity with concomitant immunosuppression of cell-mediated immune responses. In comparison, the response to the benign growth, SK, was typified by cytokines characteristic of murine THi cells that favor cell-mediated immune reactions. The findings of a distinct cytokine pattern in skin cancer provide a framework to develop strategies for immunologic intervention. (J. Clin. Invest. 1993Invest. . 91:1005Invest. -1010

Expression of interleukin 10 in human melanoma

“…Interestingly, selective expresssion of IL-10 mRNA has also been found in ovarian tumours but not in normal ovaries and ovarian tumour cell lines (Pisa et al, 1992). Moreover, our results are in line with recent published PCR data on the comparison of cytokine profiles in another malignant tumour of the skin, namely basal cell carcinoma, to that of seborrhoeic keratosis, a benign hyperplasia of epidermis (Yamamura et al, 1993). The authors noted prominent mRNA expression of IL4 and IL-10 in carcinoma specimens, but of IL-2 and interferon gamma in irritated seborrhoeic keratosis.…”

“…We next analysed SNs of these 13 melanoma cell lines and seven melanocyte cultures for IL-10 reactivity. The level of IL-10 mRNA detected in melanoma cell lines by RT-PCR correlated with the amount of IL-10 found in SNs, ranging form 0.57 ng ml-' to 3.40 ng ml-' IL-10 (Table I) (Yamamura et al, 1993). The present finding, that metastatic lesions which normally show less inflammatory response than primary melanomas (Payan et al, 1970) expressed levels of IL-10 mRNA similar to the primary tumours, together with the fact that several melanoma cell lines constitutively secreted IL-10 rather argues for the possibility that IL-10 in melanoma tissue may be produced by the tumour cells themselves.…”

A Role for CD40-CD40 Ligand Interactions in the Generation of Type 1 Cytokine Responses in Human Leprosy

“…cDNA samples were amplified in a DNA thermocycler for 35 cycles, with each cycle consisting of denaturation at 95°C for 20 s and annealing/ extension at 65°C for 45 s. The details of the PCR to verify the linearity of the appropriate controls employed have been previously described (40,41). Each PCR mixture contained 2.5 mM MgCl 2 , 0.2 mM dNTP, 25 pM 5Ј-and 3Ј-oligonucleotide primers, and 2.5 U of Taq polymerase.…”

“…The sequences of the primer pairs, 5Ј and 3Ј, were as follows: CD40, GTCTCA CAGCTTGTCCAAGGGTG and TGCTGACCGCTGATCCAGAACCA; CD40L, GCCACTGGACTGCCCATCAGCATG and CTGGCCTCACT TATGACATGTGCCGC in skin lesion biopsies, and TGAAAAAGGATAC TACACCATGAGC and GGATCAGGCACATTGACAAACAAC for Agstimulated PBMC. For comparison of CD40 or CD40L mRNA, cDNA concentrations were normalized to yield equivalent ␤-actin PCR products, as previously outlined (40,41).…”

“…To verify CD40 or CD40L mRNA, PCR products were transferred to Hybond-N nylon membranes (Amersham, Piscataway, NJ) as previously described (40,41) and probed with a labeled oligonucleotide complementary to sequences internal to the sequences recognized by the PCR amplification primers. Sequences of the oligonucleotide probes were as follows: CD40, GCACCTCAGAAACAGACACCATCT; and CD40L, AGCCAGTT-TGAAGGCTTTGTGAAGGA.…”