Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

Kallipolitis, B

doi:10.1016/s0378-1097(01)00386-x

Cited by 50 publications

(85 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…On the basis of the roles of LisRK homologs in other bacteria (103,157), as well as its regulation of a penicillin binding protein, it is likely that the growth phase variation in acid sensitivity of this mutant is linked to the regulation of cell envelope composition. The LisRK system is the only one of a number of 2CSs from Listeria that plays a role in acid stress resistance (125). In addition, of a number of PhoP-PhoS homologs identified in E. faecalis only one, EtaRS, a homolog of LisRK, had an impact on the acid resistance of the cell.…”

Section: Sigma Factorsmentioning

confidence: 99%

Surviving the Acid Test: Responses of Gram-Positive Bacteria to Low pH

Cotter

Hill

2003

Microbiol Mol Biol Rev

1,032

828

View full text Add to dashboard Cite

Gram-positive bacteria possess a myriad of acid resistance systems that can help them to overcome the challenge posed by different acidic environments. In this review the most common mechanisms are described: i.e., the use of proton pumps, the protection or repair of macromolecules, cell membrane changes, production of alkali, induction of pathways by transcriptional regulators, alteration of metabolism, and the role of cell density and cell signaling. We also discuss the reponses of Listeria monocytogenes, Rhodococcus, Mycobacterium, Clostridium perfringens, Staphylococcus aureus, Bacillus cereus, oral streptococci, and lactic acid bacteria to acidic environments and outline ways in which this knowledge has been or may be used to either aid or prevent bacterial survival in low-pH environments

show abstract

Section: Sigma Factorsmentioning

confidence: 99%

Surviving the Acid Test: Responses of Gram-Positive Bacteria to Low pH

Cotter

Hill

2003

Microbiol Mol Biol Rev

1,032

828

View full text Add to dashboard Cite

show abstract

“…Both TCSs mediate ethanol sensitivity and blactam resistance, in particular to the cephalosporins, and mutant strains lacking functional LisRK or CesRK systems are less virulent in mice than their parent wild-type stains (Cotter et al, 1999(Cotter et al, , 2002Kallipolitis et al, 2003;Kallipolitis & Ingmer, 2001). Furthermore, a lisK deletion mutant displays a growth-phase-dependent response to acidic conditions and is less tolerant to osmotic stress but more resistant to the lantibiotic nisin (Cotter et al, 1999(Cotter et al, , 2002.…”

Section: Introductionmentioning

confidence: 99%

Genome-wide transcriptional profiling of the cell envelope stress response and the role of LisRK and CesRK in Listeria monocytogenes

et al. 2012

View full text Add to dashboard Cite

The Gram-positive bacterium Listeria monocytogenes is widely distributed in the environment and capable of causing food-borne infections in susceptible individuals. In this study, we investigated the cell envelope stress response in L. monocytogenes. Whole-genome transcriptional profiling was performed to investigate the response upon exposure to the cell wall antibiotic cefuroxime. Differential expression (at least twofold) of 558 genes was observed, corresponding to 20 % of the L. monocytogenes genome. The majority of genes that were strongly induced by cefuroxime exposure have cell-envelope-related functions, including the dlt operon and the gene encoding penicillin-binding protein PBPD2. A large overlap was observed between the cefuroxime stimulon and genes known to be induced in L. monocytogenes in blood and during intracellular infection, indicating that the cell envelope stress response is active at various stages of the infectious process. We analysed the roles of the two-component systems LisRK and CesRK in the cell envelope response, showing that activation of the most highly cefuroxime-induced genes was LisR-and CesR-dependent. In addition, multiple VirRS-and LiaSR-regulated genes were found to be induced in response to cefuroxime exposure. In total, 53 % of the genes upregulated at least fourfold by cefuroxime exposure are under positive control by one of the four two-component systems. Using genetic analyses, we showed that several genes of the cefuroxime stimulon contribute to the innate resistance of L. monocytogenes to cefuroxime and tolerance to other cellenvelope-perturbing conditions. Collectively, these findings demonstrate central roles for twocomponent systems in orchestrating the cell envelope stress response in L. monocytogenes. INTRODUCTIONListeria monocytogenes is a Gram-positive, food-borne intracellular pathogen, causing life-threatening infections in susceptible individuals (Vázquez-Boland et al., 2001). L. monocytogenes is able to survive and propagate within many different environments, including soil, food processing environments, the gastrointestinal tract and the cytosol of mammalian cells. In order to adapt and multiply within such diverse and changing surroundings, L. monocytogenes must continuously monitor and respond to environmental signals by means of complex gene regulatory networks that coordinate the expression of specific sets of genes supporting bacterial survival and growth. The genome of L. monocytogenes encodes 14 two-component signal transduction systems and a single orphan response regulator which are thought to contribute to the coordinated response to various 3Present address: Molecular Genetics Group, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Nijenborgh 7, 9747 AG Groningen, The Netherlands. The microarrays used in this study were generated and designed as described by van der Veen et al. (2010) (GEO Platform no. GPL14687) and the microarray data from this study have been deposited in the GEO database with accession...

show abstract

“…L. monocytogenes can grow and survive during exposure to severe environmental stresses. It has the ability to grow over a wide pH range (pH 4.6-9), at high salt concentrations (up to 13 %), and over a wide temperature range (20.4 to 46 u C) (Kallipolitis & Ingmer, 2001;van der Veen et al, 2008). Exposure of L. monocytogenes to stress can lead to stress adaptation, due to the transcriptional activation of stress-response genes (Foster, 2007).…”

Section: Introductionmentioning

confidence: 99%

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

et al. 2010

View full text Add to dashboard Cite

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DrecA mutant strain after exposure to the DNAdamaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DrecA cultures showed considerably lower rifampicin-and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA-and yneApromoter reporter studies. Stress-survival studies showed DrecA mutant cells to be less resistant to heat, H 2 O 2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

show abstract

Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

Cited by 50 publications

References 15 publications

Surviving the Acid Test: Responses of Gram-Positive Bacteria to Low pH

Surviving the Acid Test: Responses of Gram-Positive Bacteria to Low pH

Genome-wide transcriptional profiling of the cell envelope stress response and the role of LisRK and CesRK in Listeria monocytogenes

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

Contact Info

Product

Resources

About