Lipid-Induced Peroxidation in the Intestine Is Involved in Glucose Homeostasis Imbalance in Mice

Abstract

BackgroundDaily variations in lipid concentrations in both gut lumen and blood are detected by specific sensors located in the gastrointestinal tract and in specialized central areas. Deregulation of the lipid sensors could be partly involved in the dysfunction of glucose homeostasis. The study aimed at comparing the effect of Medialipid (ML) overload on insulin secretion and sensitivity when administered either through the intestine or the carotid artery in mice.Methodology/Principal FindingsAn indwelling intragastric or intracarotid catheter was installed in mice and ML or an isocaloric solution was infused over 24 hours. Glucose and insulin tolerance and vagus nerve activity were assessed. Some mice were treated daily for one week with the anti-lipid peroxidation agent aminoguanidine prior to the infusions and tests. The intestinal but not the intracarotid infusion of ML led to glucose and insulin intolerance when compared with controls. The intestinal ML overload induced lipid accumulation and increased lipid peroxidation as assessed by increased malondialdehyde production within both jejunum and duodenum. These effects were associated with the concomitant deregulation of vagus nerve. Administration of aminoguanidine protected against the effects of lipid overload and normalized glucose homeostasis and vagus nerve activity.Conclusions/SignificanceLipid overload within the intestine led to deregulation of gastrointestinal lipid sensing that in turn impaired glucose homeostasis through changes in autonomic nervous system activity.

High-Fat Diet Induces Periodontitis in Mice through Lipopolysaccharides (LPS) Receptor Signaling: Protective Action of Estrogens

“…The primers (Eurogentec, San Diego, USA) used were (5′ to 3′): tumor necrosis factor-α ( TNF-α ), forward TGGGACAGTGACCTGGACTGT ; reverse TCGGAAAGCCCATTTGAGT ; Interleukin 1β( IL-1β ) forward TCGCTCAGGGTCACAAGAAA ; reverse CATCAGAGGCAAGGAGGAAAAC ; plasminogen activator inhibitor-1( PAI-1 ) forward ACAGCCTTTGTCATCTCAGCC ; reverse CCGAACCACAAAGAGAAAGGA and interleukin-6 ( IL-6 ) forward ACAAGTCGGAGGCTTAATTACACAT ; reverse TTGCCATTGCACAACTCTTTTC . The concentration of each mRNA was normalized for RNA loading for each sample using ribosomal protein L19 ( RPL19 ) forward GAAGGTCAAAGGGAATGTGTTCA ; reverse CCTTGTCTGCCTTCAGCTTGT , as an internal standard and the data were analysed according to the 2 −ΔΔCT method [24] .…”

A Specific Gut Microbiota Dysbiosis of Type 2 Diabetic Mice Induces GLP-1 Resistance through an Enteric NO-Dependent and Gut-Brain Axis Mechanism

“…The HFD mice are also hyperphagic and are characterized by a high metabolic rate (Burcelin et al, 2002) which prevents them from gaining much weight. The high fat content of the diet changes the intestinal morphology of the intestine with large lipid droplet within the epithelial cells (Serino et al, 2011). Interestingly, a lower macrophage infiltration has been observed as well (Serino et al, 2011).…”

Periodontitis induced byPorphyromonas gingivalisdrives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response

“…cDNA was synthesised using a reverse transcriptase (Applied Biosystems, Fost City, USA) from 1 µg of total RNA as previously explored. 28 The primers (Eurogentec, San Diego, USA) used were (5′ to 3′): TNF-α , forward TGGGACAGTGACCTGGACTGT; reverse, TCGGAAAGCCCATTTGAGT; IL-1β , forward TCGCTCAGGGTCACAAGAAA; reverse CATCAGAGGCAAGGAGGAAAAC; PAI-1 , forward ACAGCCTTTGTCATCTCAGCC; reverse CCGAACCACAAAGAGAAAGGA; and IL-6 forward ACAAGTCGGAGGCTTAATTACACAT; reverse TTGCCATTGCACAACTCTTTTC. The concentration of each mRNA was normalised for RNA loading against the ribosomal protein L19 ( RPL19 ) (forward GAAGGTCAAAGGGAATGTGTTCA; reverse CCTTGTCTGCCTTCAGCTTGT) as an internal standard, and the data were analysed according to the 2 −ΔΔCT method.…”

“…The concentration of each mRNA was normalised for RNA loading against the ribosomal protein L19 ( RPL19 ) (forward GAAGGTCAAAGGGAATGTGTTCA; reverse CCTTGTCTGCCTTCAGCTTGT) as an internal standard, and the data were analysed according to the 2 −ΔΔCT method. 28 …”