Limb-Girdle Muscular Dystrophy 2B and Miyoshi Presentations of Dysferlinopathy

Patel, Nirupa J.; Dyke, Kenneth W. Van; Espinoza, Luis R.

doi:10.1016/j.amjms.2016.05.024

Cited by 26 publications

(22 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Muscular dystrophies are heterogeneous, hereditary neuromuscular disorders and are associated with frame-disrupting or missense mutations in several genes involved in muscular structure and function 1 . Mutations in the dysferlin gene, encoding a 230 kDa transmembrane protein implicated in membrane fusion and repair 2 , are linked to clinically distinct muscle diseases, i.e., limb-girdle muscular dystrophy type 2B (LGMD2B), Miyoshi myopathy (MM) and distal myopathy with anterior tibial (DMAT) 3 , 4 ,which are also collectively referred to as dysferlinopathy, and are characterized by wasting and weakness of skeletal muscle. Dysferlinopathy generally manifests after puberty with variable severity in different muscles 5 .…”

Section: Introductionmentioning

confidence: 99%

Serum exosomes can restore cellular function in vitro and be used for diagnosis in dysferlinopathy

Dong¹,

Gao²,

Dai³

et al. 2018

Theranostics

View full text Add to dashboard Cite

Purpose: It is challenging to deliver the full-length dysferlin gene or protein to restore cellular functions of dysferlin-deficient (DYSF-/-) myofibres in dysferlinopathy, a disease caused by the absence of dysferlin, which is currently without effective treatment. Exosomes, efficient membranous nanoscale carriers of biological cargoes, could be useful.Experimental design: Myotube- and human serum-derived exosomes were investigated for their capabilities of restoring dysferlin protein and cellular functions in murine and human DYSF-/- cells. Moreover, dysferlinopathic patient serum- and urine-derived exosomes were assessed for their abilities as diagnostic tools for dysferlinopathy.Results: Here we show that exosomes from dysferlin-expressing myotubes carry abundant dysferlin and enable transfer of full-length dysferlin protein to DYSF-/- myotubes. Exogenous dysferlin correctly localizes on DYSF-/- myotube membranes, enabling membrane resealing in response to injury. Human serum exosomes also carry dysferlin protein and improve membrane repair capabilities of human DYSF-/- myotubes irrespective of mutations. Lack of dysferlin in dysferlinopathic patient serum and urine exosomes enables differentiation between healthy controls and dysferlinopathic patients.Conclusions: Our findings provide evidence that exosomes are efficient carriers of dysferlin and can be employed for the treatment and non-invasive diagnosis of dysferlinopathy.

show abstract

Section: Introductionmentioning

confidence: 99%

Serum exosomes can restore cellular function in vitro and be used for diagnosis in dysferlinopathy

Dong¹,

Gao²,

Dai³

et al. 2018

Theranostics

View full text Add to dashboard Cite

show abstract

“…Halofuginone affects this cascade of events, and acts as an efficient reagent for the improvement of muscle cells' abilities to fuse and form mature functioning myofibers, as well as for the amelioration of muscle histopathology and function at very early stages of disease initiation. Current treatments for dysferlinopathy focus on patients post-disease onset [18,19]. The results presented here offer new opportunities for early pharmaceutical treatment in dysferlinopathies with favorable outcomes at later stages of life; moreover, halofuginone is a likely candidate to fulfill the requirements for such a treatment.…”

Section: Discussionmentioning

confidence: 91%

“…Therefore, absence of dysferlin leads to delays in myofiber fusion and deficiencies in membrane resealing [3,14]. The earliest pathological signs of dysferlinopathies have been described in biopsies derived from 13-year-old patients, and current treatments focus mainly on post-disease onset [15][16][17][18][19]. The earliest pathological signs in mouse models for dysferlinopathies have been described in 8-week-old A/J-modified and 3-…”

Section: Introductionmentioning

confidence: 99%

Early pathological signs in youngdysf^−/−mice are improved by halofuginone

Barzilai-Tutsch

Genin

Pines

et al. 2019

Preprint

View full text Add to dashboard Cite

AbstractDysferlinopathies are a non-lethal group of late-onset muscular dystrophies. Here, we evaluated the fusion ability of primary myoblasts from young dysf−/− mice and the muscle histopathology prior to, and during early stages of disease onset. The ability of primary myoblasts of 5-weekold dysf−/− mice to form large myotubes was delayed compared to their wild-type counterparts, as evaluated by scanning electron microscopy. However, their fusion activity, as reflected by the presence of actin filaments connecting several cells, was enhanced by the antifibrotic drug halofuginone. Early dystrophic signs were already apparent in 4-week-old dysf−/− mice; their collagen level was double that in wild-type mice and continued to rise until 5 months of age. Continuous treatment with halofuginone from 4 weeks to 5 months of age reduced muscle fibrosis in a phosphorylated-Smad3 inhibition-related manner. Halofuginone also enhanced myofiber hypertrophy, reduced the percentage of centrally nucleated myofibers, and increased muscle performance. Together, the data suggest an inhibitory effect of halofuginone on the muscle histopathology at very early stages of dysferlinopathy, and better generation of force and muscle performance. These results offer new opportunities for early pharmaceutical treatment in dysferlinopathies with favorable outcomes at later stages of life.

show abstract

“…Dysferlinopathies are a genetically originated group of the heterogeneous disorders which include autosomal recessive muscular dystrophies 1,2. These conditions are designated by muscular weakness and muscular atrophy, while in a few cases symptoms were restricted to distal muscles.…”

mentioning

confidence: 99%

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Ullah¹,

Ahmad²,

Žarković³

et al. 2017

SMJ

View full text Add to dashboard Cite

To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

show abstract

Limb-Girdle Muscular Dystrophy 2B and Miyoshi Presentations of Dysferlinopathy

Cited by 26 publications

References 40 publications

Serum exosomes can restore cellular function in vitro and be used for diagnosis in dysferlinopathy

Serum exosomes can restore cellular function in vitro and be used for diagnosis in dysferlinopathy

Early pathological signs in youngdysf^−/−mice are improved by halofuginone

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Contact Info

Product

Resources

About

Limb-Girdle Muscular Dystrophy 2B and Miyoshi Presentations of Dysferlinopathy

Cited by 26 publications

References 40 publications

Serum exosomes can restore cellular function in vitro and be used for diagnosis in dysferlinopathy

Serum exosomes can restore cellular function in vitro and be used for diagnosis in dysferlinopathy

Early pathological signs in youngdysf−/−mice are improved by halofuginone

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Contact Info

Product

Resources

About

Early pathological signs in youngdysf^−/−mice are improved by halofuginone