Light Signaling-Dependent Regulation of Photoinhibition and Photoprotection in Tomato

Wang, Feng; Wu, Nan; Zhang, Luyue; Ahammed, Golam Jalal; Chen, Xiaoxiao; Xiao, Xiang; Zhou, Jie; Xia, Xiaojian; Shi, Kai; Yu, Jingquan; Foyer, Christine H.; Zhou, Yanhong

doi:10.1104/pp.17.01143

Cited by 86 publications

(103 citation statements)

References 80 publications

(43 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Tobacco rattle virus (TRV)‐based vectors (pTRV1/2) were used for VIGS of the SlPIF and SlGAI family genes, and VIGS was performed as described previously (Wang et al , ). The tomato pif4 mutant in the Ailsa Craig ecotype was obtained by using the CRISPR/Cas9 technique (Pan et al , ; Wang et al , ). The target sequence (AGGTCATCCAATGTGCAGCT) and its complementary sequence were annealed and inserted into the Bbs I site of the AtU6‐sgRNA‐AtUBQ‐Cas9 vector, and the AtU6‐sgRNA‐AtUBQ‐Cas9 cassette was inserted into the Hind III and Kpn I sites of the pCAMBIA1301 binary vector.…”

Section: Methodsmentioning

confidence: 99%

“…Blue light and low temperature‐induced COR27 and COR28 negatively regulate freezing tolerance in Arabidopsis (Li et al , ), whereas a low red/far‐red light ratio (L‐R/FR) induces cold tolerance in both Arabidopsis and Solanum lycopersicum (Franklin and Whitelam, ; Wang et al , , ). Intriguingly, recent work has demonstrated that Arabidopsis phytochrome B (phyB) acts as a thermosensor (Jung et al , ; Legris et al , ), and it negatively regulates cold tolerance in both Arabidopsis and tomato (Franklin and Whitelam, ; Wang et al , , ). Although we found that phytochrome A (phyA) and phyB function antagonistically to regulate cold tolerance in tomato (Wang et al , ), whether phyA or other photoreceptors are sensors for low temperature remains to be investigated.…”

Section: Introductionmentioning

confidence: 99%

“…In the natural environment, there is a significant drop in the R/FR ratio during shade and twilight periods in autumn months (Casal and Qüesta, ; Ross et al , ). L‐R/FR stabilized the AtPIF4 protein during shade avoidance (Lorrain et al ., ), and we previously demonstrated that L‐R/FR induced cold tolerance in tomato shade leaves (Wang et al , ). Therefore, whether PIF4 is the central signalling hub that integrates light and temperature to regulate cold tolerance in tomato remains to be explored.…”

Section: Introductionmentioning

confidence: 99%

“…It has been reported that light is essential for the development of cold acclimation in plants (Kim et al, 2002). Furthermore, the circadian clock, photoperiod and light quality also regulate plant cold tolerance (Dong et al, 2011;Franklin and Whitelam, 2007;Lee and Thomashow, 2012;Li et al, 2016b;Wang et al, 2016Wang et al, , 2018Wang et al, , 2019. CIRCADIAN CLOCK-ASSOCIATED 1 (CCA1)-mediated and LATE-ELONGATED HYPOCOTYL (LHY)-mediated outputs from the circadian clock positively regulate plant cold tolerance through the CBF pathway in Arabidopsis (Dong et al, 2011).…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Crosstalk of PIF4 and DELLA modulates CBF transcript and hormone homeostasis in cold response in tomato

Wang

Chen

Dong

et al. 2019

Plant Biotechnology Journal

Self Cite

View full text Add to dashboard Cite

Summary The ability to interpret daily and seasonal fluctuations, latitudinal and vegetation canopy variations in light and temperature signals is essential for plant survival. However, the precise molecular mechanisms transducing the signals from light and temperature perception to maintain plant growth and adaptation remain elusive. We show that far‐red light induces PHYTOCHROME‐INTERACTING TRANSCRIPTION 4 (SlPIF4) accumulation under low‐temperature conditions via phytochrome A in Solanum lycopersicum (tomato). Reverse genetic approaches revealed that knocking out SlPIF4 increases cold susceptibility, while overexpressing SlPIF4 enhances cold tolerance in tomato plants. SlPIF4 not only directly binds to the promoters of the C‐REPEAT BINDING FACTOR (SlCBF) genes and activates their expression but also regulates plant hormone biosynthesis and signals, including abscisic acid, jasmonate and gibberellin (GA), in response to low temperature. Moreover, SlPIF4 directly activates the SlDELLA gene (GA‐INSENSITIVE 4, SlGAI4) under cold stress, and SlGAI4 positively regulates cold tolerance. Additionally, SlGAI4 represses accumulation of the SlPIF4 protein, thus forming multiple coherent feed‐forward loops. Our results reveal that plants integrate light and temperature signals to better adapt to cold stress through shared hormone pathways and transcriptional regulators, which may provide a comprehensive understanding of plant growth and survival in a changing environment.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Crosstalk of PIF4 and DELLA modulates CBF transcript and hormone homeostasis in cold response in tomato

Wang

Chen

Dong

et al. 2019

Plant Biotechnology Journal

Self Cite

View full text Add to dashboard Cite

show abstract

“…In the process of photosynthesis, photoinhibition can occur when normally shaded leaves experience high light conditions. Phytochrome A of Arabidopsis was shown by Wang et al (2018) to be involved in the protective effect of a low R/FR light ratio, via control of the ELONGATED HYPOCOTYL5 (HY5) transcription factor. Phytochromes mediate their regulation primarily via Phytochrome Interacting Factors (PIFs), a subgroup of basic helix-loop-helix transcription factors (Leivar and Quail, 2011;Leivar and Monte, 2014).…”

Section: Phytochrome Central: Tuning Light Responses and Resource Manmentioning

confidence: 99%

The Dynamic Plant: Capture, Transformation, and Management of Energy

Bailey‐Serres¹,

Pierik²,

Ruban³

et al. 2018

Plant Physiology

View full text Add to dashboard Cite

Plants are exquisite in their capacity to convert photons of light through photosynthetic carbon dioxide (CO 2 ) fixation into carbohydrate resources that are assimilated and partitioned from photosynthetic source to sink tissues. The chemical energy gained from photosynthesis includes ATP and NADPH that along with sugars are vital to biosynthetic processes, cell proliferation, biomass production, and reproductive fitness. As in all eukaryotes, plants are dependent upon dioxygen (O 2 ) for efficient production of ATP through aerobic respiration by mitochondria. Therefore, O 2 is crucial for the efficient catabolism of carbohydrates, lipids, and protein into chemical energy in leaves in the light and darkness, as well as in sink tissues. In this Focus Issue, numerous reviews and research articles explore the integration of light, O 2 , and energy metabolism from the cellular to the whole-plant level. The articles analyze molecular, biochemical, physiological, and developmental mechanisms that contribute to the plant's energy balance. A recurrent theme is the integration of light, O 2 , and sugar sensing with signal transduction and gene regulation, resulting in metabolic and developmental plasticity that maximizes available energy for growth. This knowledge expands opportunities to enhance photosynthetic efficiency and finetune energy allocation to maximize yields of crops.

show abstract

Glycinebetaine mitigates tomato chilling stress by maintaining high-cyclic electron flow rate of photosystem I and stability of photosystem II

et al. 2022

View full text Add to dashboard Cite

Light Signaling-Dependent Regulation of Photoinhibition and Photoprotection in Tomato

Cited by 86 publications

References 80 publications

Crosstalk of PIF4 and DELLA modulates CBF transcript and hormone homeostasis in cold response in tomato

Crosstalk of PIF4 and DELLA modulates CBF transcript and hormone homeostasis in cold response in tomato

The Dynamic Plant: Capture, Transformation, and Management of Energy

Glycinebetaine mitigates tomato chilling stress by maintaining high-cyclic electron flow rate of photosystem I and stability of photosystem II

Contact Info

Product

Resources

About