Lifetime imaging of GFP at CoxVIIIa reports respiratory supercomplex assembly in live cells

Abstract

The assembly of respiratory complexes into macromolecular supercomplexes is currently a hot topic, especially in the context of newly available structural details. However, most work to date has been done with purified detergent-solubilized material and in situ confirmation is absent. We here set out to enable the recording of respiratory supercomplex formation in living cells. Fluorescent sensor proteins were placed at specific positions at cytochrome c oxidase suspected to either be at the surface of a CI1CIII2CIV1 supercomplex or buried within this supercomplex. In contrast to other loci, sensors at subunits CoxVIIIa and CoxVIIc reported a dense protein environment, as detected by significantly shortened fluorescence lifetimes. According to 3D modelling CoxVIIIa and CoxVIIc are buried in the CI1CIII2CIV1 supercomplex. Suppression of supercomplex scaffold proteins HIGD2A and CoxVIIa2l was accompanied by an increase in the lifetime of the CoxVIIIa-sensor in line with release of CIV from supercomplexes. Strikingly, our data provide strong evidence for defined stable supercomplex configuration in situ.

Respiratory supercomplexes act as a platform for complex III ‐mediated maturation of human mitochondrial complexes I and IV

“…This analysis included the relative quantification of 1,263 proteins, the most downregulated of which were structural subunits of cIII and cI (Figs 2A and EV1). These included CHCHD2, whose knock-down causes cIV deficiency (Baughman et al, 2009;Imai et al, 2019), HIGD2A, one of the human orthologs of yeast Rcf1, which stabilizes the interaction between cIII 2 and cIV (Chen et al, 2012;Strogolova et al, 2012;Vukotic et al, 2012;Rieger et al, 2017), and GHITM or growth hormone-inducible transmembrane protein, a member of the BAX inhibitor motif-containing (TMBIM) family. Conversely, the tenth cI assembly factor detected in this analysis, NDUFAF2 (Ogilvie et al, 2005), and the cII assembly factor SDHAF2 (Hao et al, 2009) were significantly more abundant in D4-CYB mitochondria.…”

“…Other proteins were also upregulated in the mutant cells. These included CHCHD2, whose knock-down causes cIV deficiency (Baughman et al, 2009;Imai et al, 2019), HIGD2A, one of the human orthologs of yeast Rcf1, which stabilizes the interaction between cIII 2 and cIV (Chen et al, 2012;Strogolova et al, 2012;Vukotic et al, 2012;Rieger et al, 2017), and GHITM or growth hormone-inducible transmembrane protein, a member of the BAX inhibitor motif-containing (TMBIM) family. GHITM localizes to the inner mitochondrial membrane, interacts with CHCHD2, and is deemed to participate in the maintenance of mitochondrial morphology and integrity (Oka et al, 2008;Meng et al, 2017).…”

The OXPHOS supercomplex assembly factor HIG2A responds to changes in energetic metabolism and cell cycle

“…We also found that HIG2A protein presents an interaction with the mitochondrial fusion protein OPA1 (Figure 6e). Rieger et al (2017) described that in HeLa cells HIGD2A suppression did F I G U R E 7 Transcriptional regulation of HIGD2A might function as a regulator of respiratory supercomplexes assembly in response to hypoxia, cellular metabolism and cell cycle. The transcription factor E2F1 is involved in this regulation of HIGD2A [Color figure can be viewed at wileyonlinelibrary.com] not influence the cellular or mitochondrial physiology (Rieger et al, 2017).…”

Pseudomonas Quinolone Signal molecule PQS behaves like a B Class inhibitor at the I Q site of mitochondrial complex I

“…To generate a matrix‐targeted HyPer‐3, the encoding sequence was genetically fused to a mitochondrial‐targeting sequence (mts) of the mitochondrial processing peptidase (MPP60) resulting in a MT‐HyPer‐3. This mts was already successfully used to target superecliptic pHluorin (sEcGFP) into the mitochondrial matrix . To generate MT‐HyPer‐3, sEcGFP was cut out from MT‐sEcGFP using EcoRI and NotI as restriction enzymes, and the sequence of HyPer‐3 was introduced.…”

“…This mts was already successfully used to target superecliptic pHluorin (sEcGFP) into the mitochondrial matrix. 48 To generate MT-HyPer-3, sEcGFP was cut out from MT-sEcGFP using EcoRI and NotI as restriction enzymes, and the sequence of HyPer-3 was introduced. The insert HyPer-3 was generated by PCR with pC1-HyPer-3 as a template using the following primers: atcggaattcatggagatggcaagccagcag (forward) and gcttgcggccgcttaaaccgcctgttttaaaacttttaaaacttttatc (reverse).…”