Lentivirus-delivered stable gene silencing by RNAi in primary cells

Stewart, Sheila A.; Dykxhoorn, Derek M.; Palliser, Deborah; Mizuno, Hana; Yu, Evan Y.; An, Dong Sung; Sabatini, David M.; Chen, Irvin S. Y.; Hahn, William C.; Sharp, Phillip A.; Weinberg, Robert A.; Novina, Carl D.

doi:10.1261/rna.2192803

Cited by 1,296 publications

(852 citation statements)

References 38 publications

Supporting

Mentioning

849

Contrasting

Unclassified

Order By: Relevance

“…HMLE and HMLE-RAS breast epithelial cell lines were derived from human mammary epithelial cells (HMECs) from Clonetics and maintained in supplemented MEGM media (Clonetics/Lonza, Walkersville, MD, USA), as described (Elenbaas et al, 2001). The shRNA design, lentivirus production and infection was done as described (Stewart et al, 2003;Rai et al, 2009). The target sequence used in this study is common to all known transcript variants of MTH1: shMTH1: 5 0 GAAATTCCACGGGTACTTCAA 3 0 (Rai et al, 2009).…”

Section: Resultsmentioning

confidence: 99%

Enhanced elimination of oxidized guanine nucleotides inhibits oncogenic RAS-induced DNA damage and premature senescence

et al. 2010

View full text Add to dashboard Cite

Approximately 20% of tumors contain activating mutations in the RAS family of oncogenes. As tumors progress to higher grades of malignancy, the expression of oncogenic RAS has been reported to increase, leading to an oncogene-induced senescence (OIS) response. Evasion of this senescence barrier is a hallmark of advanced tumors indicating that OIS serves a critical tumorsuppressive function. Induction of OIS has been attributed to either RAS-mediated production of reactive oxygen species (ROS) or to induction of a DNA damage response (DDR). However, functional links between these two processes in triggering the senescent phenotype have not been explicitly described. Our previous work has shown that, in cultured untransformed cells, preventing elimination of oxidized guanine deoxyribonucleotides, which was achieved by suppressing expression of the cellular 8-oxodGTPase, human MutT homolog 1 (MTH1), sufficed to induce a DDR as well as premature senescence. Here, we demonstrate that overexpression of MTH1 can prevent the oncogenic H-RAS-induced DDR and attendant premature senescence, although it does not affect the observed elevation in ROS levels produced by RAS oncoprotein expression. Conversely, we find that loss of MTH1 preferentially induces an in vitro proliferation defect in tumorigenic cells overexpressing oncogenic RAS. These results indicate that the guanine nucleotide pool is a critical target for intracellular ROS produced by oncogenic RAS and that RAS-transformed cells require robust MTH1 expression to proliferate.

show abstract

Section: Resultsmentioning

confidence: 99%

Enhanced elimination of oxidized guanine nucleotides inhibits oncogenic RAS-induced DNA damage and premature senescence

et al. 2010

View full text Add to dashboard Cite

show abstract

“…Lentivirus were packaged as previously described. 57 Flow cytometry. Cells were collected by scraping, washed twice with cold PBS and resupended in Nuclear Isolation and Stain (NIM-DAPI 10) from Beckman Coulter Canada (Mississauga, ON, Canada) to obtain an average concentration of 1 Â 10 6 cells/ml.…”

Section: Discussionmentioning

confidence: 99%

BimEL is phosphorylated at mitosis by Aurora A and targeted for degradation by βTrCP1

et al. 2013

View full text Add to dashboard Cite

“…The black arrow (g) points to an eGFP/ngn3 double-labelled cell. Scale bar 50 μm RNA interference can be efficiently performed using lentiviral vectors [48][49][50].…”

Section: Discussionmentioning

confidence: 99%

Efficient restricted gene expression in beta cells by lentivirus-mediated gene transfer into pancreatic stem/progenitor cells

et al. 2005

View full text Add to dashboard Cite

Aims/hypothesis: Gene transfer into pancreatic beta cells, which produce and secrete insulin, is a promising strategy to protect such cells against autoimmune destruction and also to generate beta cells in mass, thereby providing a novel therapeutic approach to treat diabetic patients. Until recently, exogenous DNA has been directly transferred into mature beta cells with various levels of success. We investigated whether exogenous DNA could be stably transferred into pancreatic stem/progenitor cells, which would subsequently differentiate into mature beta cells expressing the transgene. Methods: We designed transplantation and tissue culture procedures to obtain ex vivo models of pancreatic development. We next constructed recombinant lentiviruses expressing enhanced green fluorescent protein (eGFP) under the control of either the rat insulin promoter or a ubiquitous promoter, and performed viral infection of rat embryonic pancreatic tissue. Results: Embryonic pancreas infected with recombinant lentiviruses resulted in endocrine cell differentiation and restricted cell type expression of the transgene according to the specificity of the promoter used in the viral construct. We next demonstrated that the efficiency of infection could be further improved upon infection of embryonic pancreatic epithelia, followed by their in vitro culture, using conditions that favour endocrine cell differentiation. Under these conditions, endocrine stem/progenitor cells expressing neurogenin 3 are efficiently transduced by recombinant lentiviral vectors.Moreover, when eGFP was placed under the control of the insulin promoter, 70.4% of the developed beta cells were eGFP-expressing cells. All of the eGFP-positive cells were insulin-producing cells. Conclusions/interpretation: We have demonstrated that mature rat pancreatic beta cells can be stably modified by infecting pancreatic stem/progenitor cells that undergo endocrine differentiation.

show abstract

Lentivirus-delivered stable gene silencing by RNAi in primary cells

Cited by 1,296 publications

References 38 publications

Enhanced elimination of oxidized guanine nucleotides inhibits oncogenic RAS-induced DNA damage and premature senescence

Enhanced elimination of oxidized guanine nucleotides inhibits oncogenic RAS-induced DNA damage and premature senescence

BimEL is phosphorylated at mitosis by Aurora A and targeted for degradation by βTrCP1

Efficient restricted gene expression in beta cells by lentivirus-mediated gene transfer into pancreatic stem/progenitor cells

Contact Info

Product

Resources

About