Lamina Propria Mononuclear Cells Express and Respond to Interleukin-2 Differently in Crohn's Disease and Ulcerative Colitis.

Interleukin-6 and soluble interleukin-6 receptor in the colonic mucosa of inflammatory bowel disease

“…These results provide additional evidence to support previous studies showing that mucosal T cells are in an activated state with expression of certain cytokines, such as IL‐2 and interferon‐γ, in the intestinal lesions of CD, but not UC. 30,44,45 …”

“…The acid guanidinium thiocyanate–phenol–chloroform method was used to extract total RNA from the cell pellet of LPMC (10 4 cells) freshly isolated from colonoscopic biopsies (active CD, n = 8; active UC, n = 9; IC, n = 4; control, n = 9). 30 Extracted RNA was reverse‐tran‐scribed into complementary DNA (cDNA) at 42°C for 1 h using 0.5 μL of Rous‐associated virus 2 reverse‐transcriptase (Takara Biomedicals, Ohtsu, Japan) and 0.1 μmol/L of oligo d(T) (Pharmacia) in a 75‐μL reaction mixture. cDNA from the sample (25 μL) and standard cDNA for IL‐6 and IL‐6R (CLONTECH Labs., Palo Alto, CA, USA) were amplified in a 100‐μL reaction mixture containing 0.2 μmol/L of the sense and antisense primers for IL‐6 (CLONTECH Labs; sense, ATGAACTCCTTCTCCACAAGCGC; antisense, GAAGAGCCCTCAGGCTGGACTG), IL‐6R (CLONTECH Labs; sense, CATTGCCATTGTTCTGAGGTTC; antisense, AGTAGTCTGGATTGCTGATGTC), or β‐actin (sense, GTGGGGCGCCCCAGGCACCA; antisense, CTCCTTAATGTCACGCACGATTTC) 31 and 0.5 μL of Taq polymerase (Takara Biomedicals) for 30 (β‐actin) or 35 (IL‐6 and IL‐6R) cycles with the temperature profile consisting of 1 min at 94°C, 1 min at 60°C and 2 min at 72°C in a DNA thermal cycler (Perkin Elmer Cetus, Norwalk, CT, USA).…”

Suppressive Effects of Cyclosporine A on Neutrophils and T Cells May Be Related to Therapeutic Benefits in Patients with Steroid-Resistant Ulcerative Colitis

“…The assay for cytotoxic T cells was performed by a 51 Cr‐release assay using NK‐resistant human colonic epithelial cell‐derived HT‐29 cells (provided by Dr. Toshifumi Hibi, Keio University, Tokyo, Japan), as described previously (18,25,26). Briefly, HT‐29 target cells were detached from the vessels by trypsin treatment 1 day before the assay, washed three times, and suspended at 5 × 10 4 cells/ml in the RPMI‐1640 medium supplemented with 5% FCS and 15 mM HEPES buffer (cytotoxicity assay medium).…”

“…Spontaneous release and maximum release of 51 Cr were determined by addition of the cytotoxicity assay medium and 1% sodium dodecyl sulfate, respectively. Cytotoxicity was calculated as the percentage of specific 51 Cr release, and the results were expressed as lytic unit (LU) per 10 7 effector cells in which 1 LU is the number of effector cells required to induce 20% specific 51 Cr release from 5 × 10 3 target cells (25,26).…”

Immunoregulatory cytokines and intestinal inflammation

“…4,5 IL-7 is a pleotropic cytokine, originally described as a stromal cell-derived product, and later characterized as a strong inducer of proliferation for thymic and mature T cells. Evidence supports a role for IL-7 in mediating intestinal inflammation.…”