Lactic acid bacteria (LAB) as antimicrobials in food products

O’Bryan, Corliss A.; Crandall, Philip G.; Ricke, Steven C.; Ndahetuye, Jean Baptiste

doi:10.1016/b978-1-78242-034-7.00007-4

Cited by 20 publications

(17 citation statements)

References 60 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Sour beers are characterised by a sour taste owing to lactic acid, a major metabolite produced by LAB that lowers the pH . Typically, sour beers are characterised by a pH of 3.3–3.9, and a lactic acid content of about 3–6 g/L .…”

Section: Resultsmentioning

confidence: 99%

Sour beer production: impact of pitching sequence of yeast and lactic acid bacteria

2019

View full text Add to dashboard Cite

Lactic acid bacteria have long been used in brewing to acidify mash or wort and in the production of traditional sour beer styles (Lambic, Gueuze) using spontaneous fermentation. This approach is time consuming (some sour beers are matured for three years to obtain the appropriate flavour), so many brewers choose a faster approach using mixed cultures (yeast and bacteria). In this study, the influence of the pitching sequence of bacteria and yeast on the fermentation process was evaluated (by rate of fermentation and acidification, attenuation degree and ethanol concentration). The trials were performed using three procedures: (i) the addition of bacteria followed by the yeast; (ii) the addition of the yeast followed by the bacteria and (iii) the simultaneous addition of yeast and bacteria. In each trial the following time intervals were applied: 24, 48 and 72 h. Weight loss of samples and drop in pH were measured daily, and ethanol content, real extract and lactic acid concentration measured at the end of the process. It was shown that the order of addition of yeast and bacteria determines the success of the lactic acid fermentation. The appropriate yield of lactic acid (ca. 6 g/L) and the drop in pH (<3.6) can be achieved by inoculating the bacteria prior to the inoculation of yeast. When yeast was pitched before the bacteria, the lactic acid content was ca. 2 g/L and pH was 3.9–4.2. © 2019 The Institute of Brewing & Distilling

show abstract

Section: Resultsmentioning

confidence: 99%

Sour beer production: impact of pitching sequence of yeast and lactic acid bacteria

2019

View full text Add to dashboard Cite

show abstract

“…At the end of the 20 th century, pediocin from P. acidilactici is marketed under the commercial name Alta 2341 which was reported as a food ingredient to extend the shelf life of a variety of foods and particularly to inhibit the growth of Listeria monocytogenes in some kind of meat and meat-related products such as Frankfurters [20,21], breast meat [22] as well as fish product [23,24]. Although pediocin has remarkable and promising potential in food preservation industry and pharmaceutical, pediocin haven’t been popularly used yet because of costly production processes, which may be caused by low production yield, unstable products, and expensive downstream processing.…”

Section: Discussionmentioning

confidence: 99%

Heterologous Expression of Pediocin PA-1 inEscherichia coli

Thu

Thuy

Nghia

et al. 2019

Preprint

View full text Add to dashboard Cite

11Pediocin PA-1 is an antimicrobial peptide which has a strongly activity against some Gram -12 positive pathogens such as Listeria monocytogenes, Staphylococcus aureus, Enterococcus 13 faecalis…With the broad inhibitory spectrum as well as pH and temperature stability, pediocin has a 14 potential application in food preservation as well as pharmaceutical industry. For higher manufactory 15 efficiency, pediocin has been expressed in both prokaryote and eukaryote heterologous expression 16 system, mostly on Escherichia coli with different strategies. Here, we show a new strategy to produce 17 pediocin from Escherichia coli BL21(DE3) system as fusion form by using a vector containing NusA 18 tag. Our results showed that NusA fused pediocin almost presented in soluble form with high efficiency 19 (79.8 mg/l obtained by Ni-NTA purification). After remove the fusion tag, recombinant pediocin 20 showed antimicrobial activity against Listeria monocytogenes ATCC 13932 as 23.5x10 3 Au/mg as well 21 as against Enterococcus faecalis, Lactobacillus plantarum, and Streptococcus thermophilus, especially 22 Vibrio parahaemolyticus -a Gram-negative bacteria which have not been reported in antimicrobial 23 spectrum of pediocin on Bactibase. Recombinant pediocin is recorded to be stable to a wide range of 24 pH (1-12 for 1 hour) and temperature (100 o C for 15 min) as well as sensitive to protease treatment as Primer Sequence PedF CGCGGATCCGATGACGACGACAAGAAATATTATGGTAATGGTGTTA CCTGTGGTAAACATAGC PedR CCGCTCGAGCGGTTAACATTTATGATTACCCTGATGACCACC 60 DNA amplification product, after being treated by BamHI and XhoI restriction enzyme, 61 were then inserted into pET43.1a vector by T4 DNA ligase. The construction of pET43.1a 62 recombinant vector bearing ped gene denoted as pET43.1a -ped, was transformed into E. coli 126 by treating the purified pediocin respectively at 30, 50, 60, 70, 80, 90, 100 o C, 121 o C for 15 127 min. 128 The antimicrobial activity of pediocin was determined by agar diffusion test against the 129 indicator strain Listeria monocytogenes ATCC 13932. 130 Result 131 Construction of expression vector 132 Since pediocin is naturally produced in Pediococcus acidilactici, for expressing 133 recombinant pediocin in E. coli system, the DNA coding sequence of pediocin was analyzed 134 by Genscript Rare Codon Analysis tool in order to find out and optimize non-adaptable codons.

show abstract

“…Although LAB with antimicrobial characteristics have several potential advantages over antibiotics and chemical preservatives (O'Bryan, Crandall, Ricke, & Ndahetuye, 2015; Siedler, Balti, & Neves, 2019), their food application is also encountering some problems. The challenge for direct use of live cultures in food commodities is the growth and survival compatibility of such starter culture in different food matrices and environments.…”

Section: Food Applications Of Postbioticsmentioning

confidence: 99%

Postbiotics produced by lactic acid bacteria: The next frontier in food safety

Moradi

Kousheh

Almasi

et al. 2020

Comp Rev Food Sci Food Safe

158

View full text Add to dashboard Cite

There are many critical challenges in the use of primary and secondary cultures and their biological compounds in food commodities. An alternative is the application of postbiotics from the starter and protective lactic acid bacteria (LAB). The concept of postbiotics is relatively new and there is still not a recognized definition for this term. The word "postbiotics" is currently used to refer to bioactive compounds, which did not fit to the traditional definitions of probiotics, prebiotics, and paraprobiotics. Therefore, the postbiotics may be presently defined as bioactive soluble factors (products or metabolic byproducts), produced by some food-grade microorganisms during the growth and fermentation in complex microbiological culture (in this case named cell-free supernatant), food, or gut, which exert some benefits to the food or the consumer. Many LAB are considered probiotic and their postbiotic compounds present similar or additional health benefits to the consumer; however, this review aimed to address the most recent applications of the postbiotics with food safety purposes. The potential applications of postbiotics in food biopreservation, food packaging, and biofilm control were reviewed. The current uses of postbiotics in the reduction and biodegradation of some food safety-related chemical contaminants (e.g., biogenic amines) were considered. We also discussed the safety aspects, the obstacles, and future perspectives of using postbiotics in the food industry. This work will open up new insights for food applications of postbiotics prepared from LAB.

show abstract

Lactic acid bacteria (LAB) as antimicrobials in food products

Cited by 20 publications

References 60 publications

Sour beer production: impact of pitching sequence of yeast and lactic acid bacteria

Sour beer production: impact of pitching sequence of yeast and lactic acid bacteria

Heterologous Expression of Pediocin PA-1 inEscherichia coli

Postbiotics produced by lactic acid bacteria: The next frontier in food safety

Contact Info

Product

Resources

About