Labeling of epsilon-lysine crosslinking sites in proteins with peptide substrates of factor XIIIa and transglutaminase.

Parameswaran, K. N.; Velasco, Pauline T.; Wilson, J. H. P.; Lóránd, L.

doi:10.1073/pnas.87.21.8472

Cited by 63 publications

(63 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Even less information is available about the amine-donor protein substrates for transglutaminase, mainly due to the lack of a convenient probe. However, the use of glutamine-containing oligopeptides as probes for amine-donor substrates has recently been described (Parameswaran et al, 1990). In a similar manner, we were able to identify the amine-donor substrates in the bovine lens, using a biotinylated amine-acceptor hexapeptide modelled on the sequence around the amine-acceptor glutamine residue in PA3-crystallin.…”

mentioning

confidence: 51%

The amine‐donor substrate specificity of tissue‐type transglutaminase

Groenen

Smulders

Peters

et al. 1994

European Journal of Biochemistry

View full text Add to dashboard Cite

The amine‐donor substrate specificity of tissue‐type transglutaminase has been studied in a series of recombinant αA‐crystallin mutants. These mutant proteins have been provided with a potential substrate lysine residue, flanked by different amino acid residues, in the C‐terminal extended arm of αA‐crystallin. A biotinylated amine‐acceptor hexapeptide was used as a probe for labelling the amine‐donor sites. Wild‐type bovine αA‐crystallin does not function as an amine‐donor substrate for tissue‐type transglutaminase. Yet, upon introduction of a lysine residue at the C‐terminal or penultimate position, all mutant αA‐crystallins act as amine‐donor substrates, although to different extents. This shows that accessibility is the primary requirement for a lysine residue to function as an amine‐donor substrate for transglutaminase and that the enzyme has a broad tolerance towards the neighbouring residues. However, the nature of the flanking amino acid residues does clearly affect the reactivity of the substrate lysine residue. Notably, we found that a proline or glycine residue in front of the substrate lysine has a strong adverse effect on the substrate reactivity as compared to a preceding leucine, serine, alanine or arginine residue.

show abstract

mentioning

confidence: 51%

The amine‐donor substrate specificity of tissue‐type transglutaminase

Groenen

Smulders

Peters

et al. 1994

European Journal of Biochemistry

View full text Add to dashboard Cite

show abstract

“…For example, the expression vector for GST(QN) fusion protein with TVQQEL, the target sequence from bovine crystalline (17), was constructed using pET24d-GST(QN).Oligonucleotides encoding amino acid sequence (forward, 5Ј-CATGGATTCTCACTCTACTGTTCAA-CAAGAATTAGGTGGAGGTTC-3Ј; reverse, 5Ј-GGCCGAACCTC-CACCTAATTCTTGTTGAACAGTAGAGTGAGAATC-3Ј) (underline indicates the sequence encoding for the target peptide) were annealed and inserted into the NcoI and EagI site of pET24d-GST(QN). In regard to the other previously reported sequence, oligonucleotides were synthesized similarly except for the DNA sequence encoding for the target peptides: ␣ 2 -plasmin inhibitor (10), AATCAACAACAAGTTTCTCCTTTAACT-GGTTTAAAA (NQQQVSPLTGLK); fibronectin (11,12), CAACAAAT-TGTT (QQIV) and CCTGGTGGTCAACAAATTGTT (PGGQQIV); trappin (13) GGTCAAGATCCTGTTAAA (GQDPVK); substance P (15), CGTCCTAAACCTCAACAATTTTTTGGTTTAATG (RPKPQQFF-GLM); ␤-endorphin (22), ACTTCTGAAAAATCTCAAACTCCTT-TAGTTACT (TSEKSQTPLVT).…”

Section: Methodsmentioning

confidence: 99%

Screening for the Preferred Substrate Sequence of Transglutaminase Using a Phage-displayed Peptide Library

Sugimura

Hosono

Wada

et al. 2006

Journal of Biological Chemistry

170

169

View full text Add to dashboard Cite

Mammalian transglutaminase (TGase) catalyzes covalent crosslinking of peptide-bound lysine residues or incorporation of primary amines to limited glutamine residues in substrate proteins. Using an unbiased M13 phage display random peptide library, we developed a screening system to elucidate primary structures surrounding reactive glutamine residue(s) that are preferred by TGase. Screening was performed by selecting phage clones expressing peptides that incorporated biotin-labeled primary amine by the catalytic reactions of TGase 2 and activated Factor XIII (Factor XIIIa). We identified several amino acid sequences that were preferred as glutamine donor substrates, most of which have a marked tendency for individual TGases: TGase 2, QxPD(P), QxP, and QxxDP; Factor XIIIa, QxxxWP (where x and represent a non-conserved and a hydrophobic amino acid, respectively). We further confirmed that the sequences were favored for transamidation using modified glutathione S-transferase (GST) for recombinant peptide-GST fusion proteins. Most of the fusion proteins exhibited a considerable increase in incorporation of primary amines over that of modified GST alone. Furthermore, we identified the amino acid sequences that demonstrated higher specificity and inhibitory activity in the cross-linking reactions by TGase 2 and Factor XIIIa.Transglutaminase (TGase, 2 2.3.2.13) is an enzyme that catalyzes the formation of isopeptide cross-links between glutamine and lysine residues in a variety of proteins and also attaches other primary amines to peptide-bound glutamines (1-5). To date, eight human TGase isozymes (Factor XIII, TGases 1-7) have been identified, comprising a large protein family with unique tissue distributions and physiological roles. Among the isozymes, TGase 2 and Factor XIII are two major members, although their locations and regulation differ. TGase 2 is expressed ubiquitously and has been implicated in many biological processes, including apoptosis, stabilization of the extracellular matrix, and regulation of growth factors (6, 7). Plasma Factor XIII is synthesized as a zymogen that comprises two A and two B subunits (8). The A subunit contains the catalytic domain and is converted by thrombin-dependent proteolysis into its active form during clot formation. Activated Factor XIII (Factor XIIIa) is involved in fibrin stabilization and wound healing (9).Generally, TGase reactions involve a Ca 2ϩ -dependent acyl transfer via a double displacement mechanism. In the first step, a glutamine ␥-carboxyamide group in the substrate binds to a cysteine at the active site, resulting in formation of a ␥-glutamylthioester bond and release of ammonia. Formation of the covalent acyl enzyme intermediate is the rate-limiting step. The -amino group of a peptide-bound lysine, as a nucleophilic substrate, binds to the acyl enzyme intermediate and then attacks the thioester bond, thereby generating an intermolecular isopeptide -(␥-glutamyl)lysine cross-link. Primary amines can replace lysine in transamidation reactions and become incorp...

show abstract

“…In order to explore the functional significance of FXIII-A up-regulation in monocytederived DCs, we analyzed the effect of monodansyl-cadaverine (MDC), a competitive amino-donor for TG activity (Parameswaran et al, 1990), on cell migration using a transwell assay. In these experiments, DCs were first induced to mature and, consequently, express CCR7, which is required for cell migration (Sallusto et al, 1998).…”

Section: Fxiii-a Regulates Migration Of Dcsmentioning

confidence: 99%